Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506092

Morpholino Name: ppm1d MO1
Synonyms:
Target mRNA: ppm1d

Morpholino Type: translation blocking morpholino
Sequence: 5' CCGATATTGTTCCACACTTTCCATG 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' CATGGAAAGTGTGGAACAATATCGG 3' ||||||||||||||||||||||||| 3' GTACCTTTCACACCTTGTTATAGCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145576.1:2560508..2560532 25/25 Antisense target ppm1d
NW_022145614.1:24941219..24941243 21/25 Sense off-target lonp2
NW_022145605.1:17718212..17718236 25/25 Antisense off-target LOC115926710
Publications
First: Protein tyrosine and serine-threonine phosphatases in the sea urchin, Strongylocentrotus purpuratus: identification and potential functions., Dev Biol 2006  
Most recent:
View All Papers