Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506079

Morpholino Name: otx2 MO2
Synonyms:
Target mRNA: otx2

Morpholino Type: translation blocking morpholino
Sequence: 5' CATGTACCACTGCTTGACCGGTGCT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' AGCACCGGTCAAGCAGTGGTACATG 3' ||||||||||||||||||||||||| 3' TCGTGGCCAGTTCGTCACCATGTAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:20252386..20252410 25/25 Antisense target otx2
Publications
First: An otx cis-regulatory module: a key node in the sea urchin endomesoderm gene regulatory network., Dev Biol 2004  
Most recent: A gene regulatory network controlling the embryonic specification of endoderm., Nature 2011  
View All Papers