Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506076

Morpholino Name: otp MO1
Synonyms: Lv-Otp MO1
Target mRNA: otp

Morpholino Type: translation blocking morpholino
Sequence: 5' ACATGGGCTAGAGTTCGCTCCATTC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 24/25
genomic

MO
5' GGATGGAGCGAACTCTAGCCCATGT 3' | ||||||||||||||||||||||| 3' CTTACCTCGCTTGAGATCGGGTACA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145615.1:27291218..27291242 24/25 Antisense target otp
NW_022145615.1:27789336..27789360 24/25 Antisense off-target LOC579386
Publications
First: Identification of neural transcription factors required for the differentiation of three neuronal subtypes in the sea urchin embryo., Dev Biol 2018  
Most recent:
View All Papers