Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506063

Morpholino Name: wnt1 MO1
Synonyms:
Target mRNA: wnt1

Morpholino Type: translation blocking morpholino
Sequence: 5' ACGCTACAAACCACTCAAGTTTCAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' ATGAAACTTGAGTGGTTTGTAGCGT 3' ||||||||||||||||||||||||| 3' TACTTTGAACTCACCAAACATCGCA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145613.1:36732831..36732855 25/25 Antisense target wnt1
NW_022145534.1:1037194..1037218 22/25 Sense off-target LOC575812
NW_022145612.1:23231389..23231413 21/25 Sense off-target LOC115919370
Publications
First: Integration of canonical and noncanonical Wnt signaling pathways patterns the neuroectoderm along the anterior-posterior axis of sea urchin embryos., PLoS Biol 2013                
Most recent: Specific functions of the Wnt signaling system in gene regulatory networks throughout the early sea urchin embryo., Proc Natl Acad Sci U S A 2014  
View All Papers