Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506059

Morpholino Name: wnt16 MO2
Synonyms:
Target mRNA: wnt16

Morpholino Type: translation blocking morpholino
Sequence: 5' CAAAACATCGGTAGCTTAAATCCAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' ATGGATTTAAGCTACCGATGTTTTG 3' ||||||||||||||||||||||||| 3' TACCTAAATTCGATGGCTACAAAAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145612.1:61949769..61949793 25/25 Antisense target wnt16
NW_022145595.1:7204073..7204097 21/25 Antisense off-target LOC105445753
NW_022145595.1:8432541..8432565 21/25 Antisense off-target LOC105437004
Publications
First: A biphasic role of non-canonical Wnt16 signaling during early anterior-posterior patterning and morphogenesis of the sea urchin embryo., Development 2019                  
Most recent:
View All Papers