Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506055

Morpholino Name: wnt7b MO1
Synonyms: Wnt7 splice MO
Target mRNA: wnt7b

Morpholino Type: splice blocking morpholino
Sequence: 5' TCCTCGTCGTATATCCTTACCAGCA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 22/25
genomic

MO
5' TGCTGGTAAGGTTATACGACAACGA 3' ||||||||||| |||||||| | || 3' ACGACCATTCCTATATGCTGCTCCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145612.1:48576427..48576451 22/25 Antisense target wnt7b
Publications
First: A biphasic role of non-canonical Wnt16 signaling during early anterior-posterior patterning and morphogenesis of the sea urchin embryo., Development 2019                  
Most recent:
View All Papers