Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506053

Morpholino Name: wnt8a MO2
Synonyms:
Target mRNA: wnt8a

Morpholino Type: splice blocking morpholino
Sequence: 5' GTAAAGTGTTTTTCTTACCTTGGAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' ATCCAAGGTAAGAAAAACACTTTAC 3' ||||||||||||||||||||||||| 3' TAGGTTCCATTCTTTTTGTGAAATG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145595.1:3238892..3238916 25/25 Antisense target wnt8a
NW_022145520.1:2374001..2374025 21/25 Sense off-target LOC115921499
NW_022145596.1:9496544..9496568 21/25 Sense off-target LOC100887886
NW_022145613.1:912918..912942 21/25 Sense off-target LOC115919834
NW_022145601.1:740584..740608 21/25 unknown
NW_022145602.1:27800976..27801000 21/25 unknown
Publications
First: Integration of canonical and noncanonical Wnt signaling pathways patterns the neuroectoderm along the anterior-posterior axis of sea urchin embryos., PLoS Biol 2013                
Most recent: Canonical and non-canonical Wnt signaling pathways define the expression domains of Frizzled 5/8 and Frizzled 1/2/7 along the early anterior-posterior axis in sea urchin embryos., Dev Biol 2018  
View All Papers