Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506052

Morpholino Name: wnt8a MO1
Synonyms: SpWnt8MO1
Target mRNA: wnt8a

Morpholino Type: translation blocking morpholino
Sequence: 5' GTACACTCCAATAAAAGAAATCAAA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 24/25
genomic

MO
5' TTTGATTTCTTCTATTGGAGTGTAC 3' ||||||||||| ||||||||||||| 3' AAACTAAAGAAAATAACCTCACATG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145595.1:3239594..3239618 24/25 Antisense target wnt8a
NW_022145615.1:15097047..15097071 21/25 Sense off-target parp6
NW_022145599.1:13618655..13618679 21/25 Antisense off-target LOC592605
NW_022145611.1:9262881..9262905 21/25 Antisense off-target LOC576108
NW_022145554.1:1970500..1970524 21/25 Sense off-target LOC115918051
NW_022145595.1:22034223..22034247 22/25 unknown
NW_022145600.1:2462031..2462055 21/25 unknown
Publications
First: Nuclear beta-catenin-dependent Wnt8 signaling in vegetal cells of the early sea urchin embryo regulates gastrulation and differentiation of endoderm and mesodermal cell lineages., Genesis 2004  
Most recent: Integration of canonical and noncanonical Wnt signaling pathways patterns the neuroectoderm along the anterior-posterior axis of sea urchin embryos., PLoS Biol 2013                
View All Papers