Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506049

Morpholino Name: nodall MO7
Synonyms: TrNodal-MO1
Target mRNA: nodall

Morpholino Type: translation blocking morpholino
Sequence: 5' ATGCATGGTTAAAAGTCCGTAAAGT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 22/25
genomic

MO
5' TTTTTAAGGACTTTTAACCATGCAT 3' |||| |||||||||||||||||| 3' TGAAATGCCTGAAAATTGGTACGTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145595.1:2652432..2652456 22/25 Antisense target nodall
Publications
First: Transforming growth factor-β signal regulates gut bending in the sea urchin embryo., Dev Growth Differ 2018  
Most recent:
View All Papers