Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506048

Morpholino Name: nodall MO6
Synonyms:
Target mRNA: nodall

Morpholino Type: translation blocking morpholino
Sequence: 5' TCAAGTTCTTGGTCATTCTCGAAAC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145607.1:12900494..12900518 22/25 Antisense off-target LOC582001
NW_022145601.1:10827415..10827439 21/25 Sense off-target LOC577129
NW_022145603.1:20285749..20285773 21/25 Antisense off-target LOC115925476
Publications
First: Nodal induces sequential restriction of germ cell factors during primordial germ cell specification., Development 2018            
Most recent:
View All Papers