Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506046

Morpholino Name: nodall MO4
Synonyms:
Target mRNA: nodall

Morpholino Type: translation blocking morpholino
Sequence: 5' GATGTCTCAGCTCTCTGAAATGTAG 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' CTACATTTCAGAGAGCTGAGACATC 3' ||||||||||||||||||||||||| 3' GATGTAAAGTCTCTCGACTCTGTAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145595.1:2652371..2652395 25/25 Antisense target nodall
NW_022145604.1:20413565..20413589 21/25 unknown
NW_022145606.1:22506144..22506168 21/25 unknown
NW_022145613.1:34830146..34830170 21/25 unknown
Publications
First: The sea urchin animal pole domain is a Six3-dependent neurogenic patterning center., Development 2009  
Most recent: Canonical and non-canonical Wnt signaling pathways define the expression domains of Frizzled 5/8 and Frizzled 1/2/7 along the early anterior-posterior axis in sea urchin embryos., Dev Biol 2018  
View All Papers