Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506045

Morpholino Name: nodall MO3
Synonyms: Nodal-MASO
Target mRNA: nodall

Morpholino Type: translation blocking morpholino
Sequence: 5' TGCATGGTTAAAAGTCCTTAAAAAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' ATTTTTAAGGACTTTTAACCATGCA 3' ||||||||||||||||||||||||| 3' TAAAAATTCCTGAAAATTGGTACGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145595.1:2652431..2652455 25/25 Antisense target nodall
Publications
First: Cis-regulatory control of the nodal gene, initiator of the sea urchin oral ectoderm gene network., Dev Biol 2007  
Most recent: Genome editing in sea urchin embryos by using a CRISPR/Cas9 system., Dev Biol 2016  
View All Papers