Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506043

Morpholino Name: nodall MO1
Synonyms:
Target mRNA: nodall

Morpholino Type: translation blocking morpholino
Sequence: 5' AGTGACGACATCGTTCCAGCAAAGC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 24/25
genomic

MO
5' GCTTCGCTGGAACGATGTCGTCACT 3' |||| |||||||||||||||||||| 3' CGAAACGACCTTGCTACAGCAGTGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145595.1:2652398..2652422 24/25 Sense target nodall
Publications
First: Nodal/activin signaling establishes oral-aboral polarity in the early sea urchin embryo., Dev Dyn 2004  
Most recent:
View All Papers