Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506042

Morpholino Name: nkx2-1 MO1
Synonyms:
Target mRNA: nkx2-1

Morpholino Type: translation blocking morpholino
Sequence: 5' TGGTCTGTTTAGGGCTATATGACAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 24/25
genomic

MO
5' ATGTCATATAGCCCCAAACAGACCA 3' |||||||||||||| |||||||||| 3' TACAGTATATCGGGATTTGTCTGGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:17971625..17971649 24/25 Antisense target nkx2-1
Publications
First: ankAT-1 is a novel gene mediating the apical tuft formation in the sea urchin embryo., Dev Biol 2010  
Most recent:
View All Papers