Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506040

Morpholino Name: neurog2l MO2
Synonyms: Lv-Ngn MO2
Target mRNA: neurog2l

Morpholino Type: translation blocking morpholino
Sequence: 5' ATGGATATGCCCTTCTCCTCTAATT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 21/25
genomic

MO
5' ATTTGCAGGAGAAGGGCGTATCCAT 3' | || ||||||||||| ||||||| 3' TTAATCTCCTCTTCCCGTATAGGTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145595.1:5956646..5956670 21/25 Antisense target neurog2l
NW_022145604.1:20919926..20919950 21/25 unknown
NW_022145604.1:20928832..20928856 21/25 unknown
Publications
First: Identification of neural transcription factors required for the differentiation of three neuronal subtypes in the sea urchin embryo., Dev Biol 2018  
Most recent:
View All Papers