Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506036

Morpholino Name: meis1 MO1
Synonyms: Hp-Meis-MO, HpMeis-MO1
Target mRNA: meis1

Morpholino Type: translation blocking morpholino
Sequence: 5' TCGTAACCCCTCTGTGCCATGTCGC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: Meis transcription factor maintains the neurogenic ectoderm and regulates the anterior-posterior patterning in embryos of a sea urchin, Hemicentrotus pulcherrimus., Dev Biol 2018  
Most recent: cis-Regulatory analysis for later phase of anterior neuroectoderm-specific foxQ2 expression in sea urchin embryos., Genesis 2019  
View All Papers