Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506014

Morpholino Name: LOC100891244 MO1
Synonyms: SpGalnt13MO1
Target mRNA: LOC100891244

Morpholino Type: splice blocking morpholino
Sequence: 5' CGACTCGAGTACTGAAGAGGGAGAA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' TTCTCCCTCTTCAGTACTCGAGTCG 3' ||||||||||||||||||||||||| 3' AAGAGGGAGAAGTCATGAGCTCAGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145604.1:20207913..20207937 25/25 Antisense target LOC100891244
NW_022145553.1:247676..247700 25/25 Antisense off-target LOC115926788
Publications
First: Characterization and expression analysis of Galnts in developing Strongylocentrotus purpuratus embryos., PLoS One 2017              
Most recent:
View All Papers