Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506008

Morpholino Name: lefty1 MO1
Synonyms: Lefty-MO
Target mRNA: lefty1

Morpholino Type: translation blocking morpholino
Sequence: 5' AGCACCGAGTGATAATTCCATATTG 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' CAATATGGAATTATCACTCGGTGCT 3' ||||||||||||||||||||||||| 3' GTTATACCTTAATAGTGAGCCACGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:15747151..15747175 25/25 Antisense target lefty1
NW_022145598.1:12568893..12568917 21/25 Antisense off-target tfap2a
NW_022145607.1:20338654..20338678 22/25 Antisense off-target LOC757218
NW_022145613.1:38140756..38140780 21/25 Antisense off-target LOC581963
Publications
First: TGFβ signaling positions the ciliary band and patterns neurons in the sea urchin embryo., Dev Biol 2010  
Most recent: ankAT-1 is a novel gene mediating the apical tuft formation in the sea urchin embryo., Dev Biol 2010  
View All Papers