Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24506000

Morpholino Name: hbox7 MO1
Synonyms:
Target mRNA: Hbox7

Morpholino Type: translation blocking morpholino
Sequence: 5' AGCCTGTTCCATGCCGATCTGCAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 24/24
genomic

MO
5' ATGCAGATCGGCATGGAACAGGCT 3' |||||||||||||||||||||||| 3' TACGTCTAGCCGTACCTTGTCCGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145612.1:38147744..38147767 24/24 Antisense target Hbox7
Publications
First: Hindgut specification and cell-adhesion functions of Sphox11/13b in the endoderm of the sea urchin embryo., Dev Growth Differ 2006  
Most recent:
View All Papers