Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505997

Morpholino Name: gpsm1 MO1
Synonyms:
Target mRNA: gpsm1

Morpholino Type: translation blocking morpholino
Sequence: 5' GGCCCGTTTCACAAAGCCTTTGTTT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 21/25
genomic

MO
5' GAAAAAAGGCTTTGTGAAAAGGGTC 3' || ||||||||||||||| ||| | 3' TTTGTTTCCGAAACACTTTGCCCGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145610.1:22863319..22863343 24/25 Antisense target gpsm1
NW_022145610.1:22851557..22851581 21/25 Sense target gpsm1
NW_022145596.1:9626695..9626719 21/25 Antisense off-target ik
NW_022145613.1:9333145..9333169 23/25 Sense off-target a2m
NW_022145614.1:25845142..25845166 23/25 Antisense off-target tk2
NW_022145601.1:12390453..12390477 22/25 Sense off-target srm
NW_022145606.1:16904596..16904620 22/25 Antisense off-target vcl
NW_022145613.1:17356085..17356109 22/25 Antisense off-target NBC
NW_022145613.1:30884379..30884403 22/25 Antisense off-target adv
NW_022145615.1:1826475..1826499 22/25 Sense off-target jtb
NW_022145595.1:9442431..9442455 22/25 Sense off-target wrn
NW_022145596.1:28646948..28646972 22/25 Sense off-target ogt
NW_022145598.1:24940801..24940825 21/25 Antisense off-target tpr
NW_022145598.1:25370687..25370711 21/25 Sense off-target hck
NW_022145598.1:35094760..35094784 21/25 Sense off-target frk
NW_022145598.1:35100451..35100475 21/25 Sense off-target frk
NW_022145598.1:35108189..35108213 21/25 Sense off-target frk
NW_022145599.1:36289439..36289463 21/25 Sense off-target unk
NW_022145603.1:13385498..13385522 21/25 Antisense off-target mgb
NW_022145605.1:24400854..24400878 21/25 Sense off-target hpd
NW_022145605.1:34560240..34560264 21/25 Antisense off-target por
NW_022145605.1:41092892..41092916 21/25 Antisense off-target pxn
NW_022145606.1:16862571..16862595 21/25 Sense off-target vcl
NW_022145606.1:16894996..16895020 21/25 Sense off-target vcl
NW_022145609.1:30576426..30576450 21/25 Sense off-target agl
NW_022145609.1:32247022..32247046 21/25 Sense off-target tek
NW_022145610.1:21888856..21888880 21/25 Antisense off-target c3l
NW_022145610.1:9150705..9150729 21/25 Antisense off-target myp
NW_022145613.1:9357530..9357554 21/25 Antisense off-target a2m
NW_022145615.1:25112153..25112177 21/25 Sense off-target blm
NW_022145571.1:719595..719619 21/25 Antisense off-target nf1
NW_022145595.1:13998328..13998352 21/25 Antisense off-target ret
NW_022145597.1:27584157..27584181 21/25 Sense off-target rb1
NW_022145603.1:17354120..17354144 24/25 Antisense off-target m1ap
NW_022145598.1:16134993..16135017 24/25 Sense off-target ptk2
NW_022145600.1:10680469..10680493 23/25 Antisense off-target smc3
NW_022145601.1:12412658..12412682 23/25 Antisense off-target mib2
NW_022145603.1:15201649..15201673 23/25 Sense off-target lmo2
NW_022145603.1:16619605..16619629 23/25 Antisense off-target pax6
NW_022145604.1:12407900..12407924 23/25 Antisense off-target pan2
NW_022145605.1:2317130..2317154 23/25 Sense off-target rfc2
NW_022145607.1:23911980..23912004 23/25 Sense off-target pex7
NW_022145607.1:40413615..40413639 23/25 Antisense off-target msh2
NW_022145609.1:15920698..15920722 23/25 Sense off-target rfx2
NW_022145609.1:1600348..1600372 23/25 Antisense off-target stil
NW_022145609.1:28455209..28455233 23/25 Antisense off-target sia2
NW_022145609.1:37273286..37273310 23/25 Antisense off-target sdk2
NW_022145610.1:35347086..35347110 23/25 Antisense off-target whrn
NW_022145611.1:23835370..23835394 23/25 Antisense off-target rce1
NW_022145613.1:2519481..2519505 23/25 Sense off-target lig4
NW_022145614.1:3411527..3411551 23/25 Sense off-target gas8
NW_022145594.1:17495423..17495447 23/25 Antisense off-target usf2
NW_022145594.1:17664455..17664479 23/25 Sense off-target treh
NW_022145594.1:22210631..22210655 23/25 Sense off-target etfb
NW_022145594.1:27779706..27779730 23/25 Antisense off-target pole
NW_022145595.1:26601698..26601722 23/25 Antisense off-target melk
NW_022145598.1:17581645..17581669 22/25 Antisense off-target nfyc
NW_022145598.1:19239587..19239611 22/25 Sense off-target ppie
NW_022145598.1:22837907..22837931 22/25 Sense off-target taf2
NW_022145598.1:27683530..27683554 22/25 Sense off-target SFK7
NW_022145598.1:35985258..35985282 22/25 Antisense off-target kdm8
NW_022145600.1:11706727..11706751 22/25 Antisense off-target ngdn
NW_022145600.1:12407337..12407361 22/25 Sense off-target PRP1
NW_022145600.1:16774014..16774038 22/25 Sense off-target ldb2
NW_022145600.1:17982781..17982805 22/25 Sense off-target nagk
NW_022145600.1:36264198..36264222 22/25 Antisense off-target sil1
NW_022145601.1:15301607..15301631 22/25 Antisense off-target opa1
NW_022145601.1:15820203..15820227 22/25 Sense off-target gch1
NW_022145603.1:17358377..17358401 22/25 Sense off-target m1ap
NW_022145603.1:4360048..4360072 22/25 Antisense off-target lin9
NW_022145604.1:10519884..10519908 22/25 Sense off-target rif1
NW_022145604.1:12535299..12535323 22/25 Sense off-target avl9
NW_022145605.1:16664171..16664195 22/25 Antisense off-target mks1
NW_022145605.1:24223173..24223197 22/25 Antisense off-target hira
NW_022145605.1:24223368..24223392 22/25 Antisense off-target hira
NW_022145606.1:6140102..6140126 22/25 Antisense off-target mybb
NW_022145607.1:27628493..27628517 22/25 Sense off-target rpgr
NW_022145607.1:40917651..40917675 22/25 Sense off-target drp2
NW_022145609.1:29650810..29650834 22/25 Antisense off-target rcl1
NW_022145611.1:17902476..17902500 22/25 Sense off-target xrn2
NW_022145611.1:24304524..24304548 22/25 Antisense off-target mta2
NW_022145611.1:7347013..7347037 22/25 Sense off-target haao
NW_022145611.1:7605210..7605234 22/25 Sense off-target xpo5
NW_022145611.1:9762684..9762708 22/25 Antisense off-target gnmt
NW_022145611.1:9776498..9776522 22/25 Sense off-target gnmt
NW_022145612.1:40355518..40355542 22/25 Sense off-target msh4
NW_022145612.1:42561470..42561494 22/25 Antisense off-target hbp1
NW_022145612.1:43573820..43573844 22/25 Antisense off-target ilf2
NW_022145612.1:42217245..42217269 22/25 Antisense off-target aass
NW_022145613.1:10799851..10799875 22/25 Sense off-target kynu
NW_022145613.1:11544109..11544133 22/25 Antisense off-target stam
NW_022145613.1:10815959..10815983 22/25 Sense off-target kynu
NW_022145613.1:30833446..30833470 22/25 Antisense off-target ola1
NW_022145613.1:8713718..8713742 22/25 Antisense off-target srrt
NW_022145614.1:15607944..15607968 22/25 Sense off-target trhr
NW_022145614.1:22026674..22026698 22/25 Antisense off-target rttn
NW_022145614.1:25931466..25931490 22/25 Sense off-target cdt1
NW_022145614.1:6701310..6701334 22/25 Antisense off-target gmds
NW_022145614.1:8066385..8066409 22/25 Sense off-target tmx3
NW_022145615.1:21756440..21756464 22/25 Sense off-target edc3
NW_022145615.1:32432646..32432670 22/25 Sense off-target smc6
NW_022145615.1:28255764..28255788 22/25 Antisense off-target upf1
NW_022145594.1:27819915..27819939 22/25 Sense off-target pole
NW_022145594.1:3365497..3365521 22/25 Sense off-target ei24
NW_022145595.1:22449024..22449048 22/25 Sense off-target cdk1
NW_022145596.1:14955251..14955275 22/25 Sense off-target inf2
NW_022145596.1:524415..524439 22/25 Antisense off-target ubn2
NW_022145597.1:18019261..18019285 22/25 Antisense off-target daw1
NW_022145597.1:21375245..21375269 22/25 Sense off-target iws1
NW_022145597.1:31953932..31953956 22/25 Sense off-target pex1
NW_022145598.1:16086841..16086865 22/25 Antisense off-target ptk2
NW_022145598.1:17803465..17803489 21/25 Sense off-target SFK1
NW_022145598.1:21494333..21494357 21/25 Sense off-target ccm2
NW_022145599.1:11923973..11923997 21/25 Sense off-target nuf2
NW_022145599.1:12925584..12925608 21/25 Antisense off-target pgs1
NW_022145599.1:16761511..16761535 21/25 Sense off-target parn
NW_022145600.1:18184792..18184816 21/25 Sense off-target nhp2
NW_022145600.1:35907578..35907602 21/25 Antisense off-target wdr1
NW_022145601.1:15324850..15324874 21/25 Sense off-target opa1
NW_022145601.1:23493641..23493665 21/25 Antisense off-target mtor
NW_022145601.1:3036511..3036535 21/25 Antisense off-target kazn
NW_022145601.1:3056003..3056027 21/25 Sense off-target kazn
NW_022145601.1:3057781..3057805 21/25 Antisense off-target kazn
NW_022145601.1:4195162..4195186 21/25 Sense off-target sdf4
NW_022145601.1:9719823..9719847 21/25 Sense off-target rev1
NW_022145603.1:13281201..13281225 21/25 Sense off-target etv6
NW_022145603.1:17170211..17170235 21/25 Antisense off-target sox5
NW_022145603.1:17177307..17177331 21/25 Antisense off-target sox5
NW_022145603.1:26193716..26193740 21/25 Sense off-target nop9
NW_022145603.1:27446057..27446081 21/25 Antisense off-target pifo
NW_022145603.1:8320017..8320041 21/25 Sense off-target ctr9
NW_022145603.1:9290733..9290757 21/25 Sense off-target madd
NW_022145603.1:9513230..9513254 21/25 Antisense off-target aspm
NW_022145604.1:10554182..10554206 21/25 Antisense off-target rif1
NW_022145605.1:12844434..12844458 21/25 Antisense off-target gle1
NW_022145605.1:13271048..13271072 21/25 Antisense off-target elob
NW_022145605.1:14990556..14990580 21/25 Sense off-target brap
NW_022145605.1:20964033..20964057 21/25 Antisense off-target stn1
NW_022145605.1:32648163..32648187 21/25 Sense off-target denr
NW_022145605.1:40613872..40613896 21/25 Sense off-target wsb1
NW_022145606.1:12975770..12975794 21/25 Sense off-target h6pd
NW_022145606.1:35372092..35372116 21/25 Antisense off-target myg1
NW_022145607.1:18622039..18622063 21/25 Antisense off-target nox4
NW_022145607.1:22809910..22809934 21/25 Antisense off-target zup1
NW_022145607.1:35117691..35117715 21/25 Antisense off-target mlh1
NW_022145607.1:37173169..37173193 21/25 Sense off-target ibtk
NW_022145607.1:40387255..40387279 21/25 Sense off-target msh2
NW_022145607.1:8292463..8292487 21/25 Sense off-target hlcs
NW_022145609.1:15923576..15923600 21/25 Sense off-target rfx2
NW_022145609.1:37284265..37284289 21/25 Antisense off-target sdk2
NW_022145609.1:38635279..38635303 21/25 Antisense off-target gldc
NW_022145611.1:23829058..23829082 21/25 Antisense off-target rce1
NW_022145611.1:28775386..28775410 21/25 Sense off-target lyst
NW_022145611.1:30607911..30607935 21/25 Sense off-target mcm8
NW_022145611.1:9942514..9942538 21/25 Antisense off-target kif6
NW_022145612.1:20155910..20155934 21/25 Antisense off-target tep1
NW_022145612.1:41890775..41890799 21/25 Antisense off-target iqub
NW_022145613.1:14683395..14683419 21/25 Sense off-target ago4
NW_022145613.1:30804387..30804411 21/25 Antisense off-target dna2
NW_022145613.1:38765351..38765375 21/25 Sense off-target cd63
NW_022145614.1:23381374..23381398 21/25 Antisense off-target SPCA
NW_022145614.1:26686188..26686212 21/25 Sense off-target edc4
NW_022145614.1:26695238..26695262 21/25 Sense off-target edc4
NW_022145614.1:29938735..29938759 21/25 Antisense off-target ddx1
NW_022145615.1:10877269..10877293 21/25 Sense off-target mtx1
NW_022145594.1:17987174..17987198 21/25 Antisense off-target erfl
NW_022145594.1:20178078..20178102 21/25 Sense off-target cicl
NW_022145594.1:34611250..34611274 21/25 Antisense off-target chk1
NW_022145595.1:26624376..26624400 21/25 Sense off-target melk
NW_022145595.1:25697247..25697271 21/25 Antisense off-target pbld
NW_022145595.1:8886753..8886777 21/25 Sense off-target dlg5
NW_022145596.1:13898758..13898782 21/25 Sense off-target guf1
NW_022145596.1:32530917..32530941 21/25 Antisense off-target ncdn
NW_022145596.1:32534725..32534749 21/25 Sense off-target ncdn
NW_022145597.1:17415129..17415153 21/25 Antisense off-target smc4
NW_022145597.1:17430919..17430943 21/25 Sense off-target smc4
NW_022145597.1:22602916..22602940 21/25 Sense off-target cul3
NW_022145597.1:21367796..21367820 21/25 Sense off-target iws1
NW_022145597.1:5630948..5630972 21/25 Antisense off-target hltf
NW_022145597.1:5863855..5863879 21/25 Sense off-target med4
NW_022145598.1:16086515..16086539 21/25 Sense off-target ptk2
NW_022145598.1:4071500..4071524 23/25 Sense off-target cse1l
NW_022145599.1:37292908..37292932 23/25 Antisense off-target abcc6
NW_022145599.1:4476623..4476647 23/25 Antisense off-target dnah3
NW_022145601.1:11098080..11098104 23/25 Sense off-target copb2
NW_022145601.1:21637431..21637455 23/25 Sense off-target abcb4
NW_022145603.1:17060399..17060423 23/25 Sense off-target arntl
NW_022145605.1:39539323..39539347 23/25 Antisense off-target rogdi
NW_022145606.1:18985172..18985196 23/25 Antisense off-target rfwd3
NW_022145610.1:22775071..22775095 23/25 Antisense off-target med22
NW_022145610.1:2790805..2790829 23/25 Sense off-target lamc1
NW_022145610.1:31856238..31856262 23/25 Antisense off-target wdr47
NW_022145611.1:21748342..21748366 23/25 Sense off-target plcb4
NW_022145611.1:6512202..6512226 23/25 Antisense off-target eef1g
NW_022145612.1:13697852..13697876 23/25 Antisense off-target slmap
NW_022145612.1:19546034..19546058 23/25 Antisense off-target lrrk2
NW_022145612.1:39675163..39675187 23/25 Sense off-target baz2b
NW_022145613.1:32031082..32031106 23/25 Antisense off-target ttc25
NW_022145613.1:9268193..9268217 23/25 Antisense off-target ints9
NW_022145615.1:28037031..28037055 23/25 Antisense off-target ipo11
NW_022145594.1:17258890..17258914 23/25 Antisense off-target sorl1
NW_022145594.1:29860993..29861017 23/25 Sense off-target gsk3a
NW_022145596.1:1066362..1066386 23/25 Antisense off-target herc2
NW_022145596.1:17722168..17722192 23/25 Sense off-target fbxw7
NW_022145596.1:25625216..25625240 23/25 Sense off-target eif5b
NW_022145598.1:9556514..9556538 22/25 Sense off-target ppm1g
NW_022145599.1:13022951..13022975 22/25 Antisense off-target pcyt2
NW_022145599.1:16879247..16879271 22/25 Antisense off-target ercc6
NW_022145599.1:21645579..21645603 22/25 Antisense off-target prkca
NW_022145599.1:28845076..28845100 22/25 Antisense off-target zzef1
NW_022145599.1:29377980..29378004 22/25 Sense off-target rptor
NW_022145599.1:4485713..4485737 22/25 Sense off-target dnah3
NW_022145599.1:7628417..7628441 22/25 Sense off-target sgsm3
NW_022145601.1:21864412..21864436 22/25 Sense off-target prdm2
NW_022145601.1:33256910..33256934 22/25 Antisense off-target lekr1
NW_022145601.1:3597689..3597713 22/25 Antisense off-target nphp4
NW_022145602.1:12149329..12149353 22/25 Antisense off-target arid2
NW_022145602.1:5392021..5392045 22/25 Antisense off-target rras2
NW_022145602.1:9751196..9751220 22/25 Antisense off-target tmtc1
NW_022145603.1:16655761..16655785 22/25 Sense off-target ttll1
NW_022145603.1:17040458..17040482 22/25 Antisense off-target ckap5
NW_022145603.1:14151368..14151392 22/25 Antisense off-target fnbp4
NW_022145603.1:17573490..17573514 22/25 Antisense off-target cecr2
NW_022145603.1:17058714..17058738 22/25 Antisense off-target arntl
NW_022145603.1:17063088..17063112 22/25 Antisense off-target arntl
NW_022145603.1:28483886..28483910 22/25 Antisense off-target saal1
NW_022145604.1:12936433..12936457 22/25 Sense off-target trrap
NW_022145604.1:12379237..12379261 22/25 Sense off-target cmahp
NW_022145604.1:18678286..18678310 22/25 Sense off-target catip
NW_022145604.1:23051267..23051291 22/25 Sense off-target nek10
NW_022145604.1:29573493..29573517 22/25 Antisense off-target dlec1
NW_022145604.1:6677208..6677232 22/25 Sense off-target abcb1
NW_022145605.1:12516743..12516767 22/25 Sense off-target nup88
NW_022145605.1:6410599..6410623 22/25 Sense off-target prpf8
NW_022145606.1:36727414..36727438 22/25 Sense off-target sf3a2
NW_022145606.1:43388032..43388056 22/25 Sense off-target synj1
NW_022145606.1:46073766..46073790 22/25 Sense off-target sfrp5
NW_022145606.1:9924798..9924822 22/25 Antisense off-target efnb1
NW_022145607.1:12646331..12646355 22/25 Antisense off-target igf2r
NW_022145607.1:18158926..18158950 22/25 Sense off-target ift88
NW_022145607.1:23881430..23881454 22/25 Sense off-target yars1
NW_022145607.1:19758671..19758695 22/25 Sense off-target sf3a3
NW_022145607.1:28336189..28336213 22/25 Antisense off-target apex1
NW_022145609.1:19455966..19455990 22/25 Sense off-target wdr18
NW_022145609.1:20591273..20591297 22/25 Antisense off-target ap3d1
NW_022145609.1:22166930..22166954 22/25 Sense off-target wdr78
NW_022145609.1:33850229..33850253 22/25 Antisense off-target ift74
NW_022145609.1:31551767..31551791 22/25 Antisense off-target fcho2
NW_022145610.1:17524550..17524574 22/25 Antisense off-target hspa5
NW_022145610.1:20647950..20647974 22/25 Sense off-target abca2
NW_022145610.1:22737431..22737455 22/25 Antisense off-target vars1
NW_022145611.1:11865973..11865997 22/25 Sense off-target psme4
NW_022145611.1:34548974..34548998 22/25 Sense off-target acss1
NW_022145611.1:36522793..36522817 22/25 Sense off-target wdr92
NW_022145611.1:5220104..5220128 22/25 Sense off-target usp34
NW_022145612.1:21580112..21580136 22/25 Sense off-target kdm5a
NW_022145612.1:21726412..21726436 22/25 Antisense off-target rad52
NW_022145612.1:28783585..28783609 22/25 Antisense off-target mus81
NW_022145612.1:38225222..38225246 22/25 Sense off-target hoxb6
NW_022145612.1:53731965..53731989 22/25 Sense off-target usp19
NW_022145612.1:53746852..53746876 22/25 Sense off-target usp19
NW_022145612.1:4771108..4771132 22/25 Sense off-target myo1b
NW_022145613.1:15270065..15270089 22/25 Antisense off-target vps11
NW_022145613.1:26179363..26179387 22/25 Sense off-target mrto4
NW_022145614.1:16112117..16112141 22/25 Antisense off-target gnao1
NW_022145614.1:19786079..19786103 22/25 Sense off-target stx16
NW_022145614.1:2062566..2062590 22/25 Antisense off-target acot8
NW_022145614.1:29874679..29874703 22/25 Sense off-target sf3b3
NW_022145614.1:33095567..33095591 22/25 Sense off-target wdr89
NW_022145614.1:4140084..4140108 22/25 Antisense off-target mroh1
NW_022145614.1:8451956..8451980 22/25 Antisense off-target virma
NW_022145615.1:10227949..10227973 22/25 Sense off-target herc1
NW_022145615.1:1576833..1576857 22/25 Sense off-target ddx49
NW_022145615.1:20943411..20943435 22/25 Antisense off-target nr2f2
NW_022145615.1:31859122..31859146 22/25 Antisense off-target duox1
NW_022145594.1:29857211..29857235 22/25 Antisense off-target gsk3a
NW_022145594.1:32561788..32561812 22/25 Antisense off-target esrrg
NW_022145594.1:29856671..29856695 22/25 Sense off-target gsk3a
NW_022145594.1:42707230..42707254 22/25 Antisense off-target xrcc1
NW_022145596.1:11993944..11993968 22/25 Sense off-target asah1
NW_022145596.1:12190582..12190606 22/25 Sense off-target ccng2
NW_022145596.1:1064286..1064310 22/25 Sense off-target herc2
NW_022145596.1:24695275..24695299 22/25 Antisense off-target thoc2
NW_022145597.1:268516..268540 22/25 Sense off-target eif2a
NW_022145597.1:28072874..28072898 22/25 Sense off-target uvrag
NW_022145597.1:532221..532245 22/25 Antisense off-target cdc16
NW_022145598.1:15967380..15967404 22/25 Antisense off-target dscc1
NW_022145598.1:20476056..20476080 21/25 Antisense off-target thoc1
NW_022145598.1:3127613..3127637 21/25 Sense off-target ift52
NW_022145598.1:35149953..35149977 21/25 Sense off-target uckl1
NW_022145598.1:65625..65649 21/25 Sense off-target cspp1
NW_022145599.1:12960260..12960284 21/25 Sense off-target wdr13
NW_022145599.1:17079523..17079547 21/25 Antisense off-target ube2o
NW_022145599.1:2799857..2799881 21/25 Sense off-target myh11
NW_022145599.1:28842596..28842620 21/25 Sense off-target zzef1
NW_022145599.1:3631246..3631270 21/25 Sense off-target cd109
NW_022145599.1:3641540..3641564 21/25 Antisense off-target cd109
NW_022145599.1:5490860..5490884 21/25 Antisense off-target pdpk1
NW_022145599.1:7639163..7639187 21/25 Antisense off-target sgsm3
NW_022145599.1:7962065..7962089 21/25 Antisense off-target cnpy4
NW_022145600.1:18427376..18427400 21/25 Sense off-target adprs
NW_022145600.1:22449638..22449662 21/25 Sense off-target eif3a
NW_022145600.1:23954972..23954996 21/25 Sense off-target uvssa
NW_022145600.1:35276287..35276311 21/25 Antisense off-target wdr34
NW_022145601.1:11096849..11096873 21/25 Sense off-target copb2
NW_022145600.1:8302188..8302212 21/25 Antisense off-target kctd9
NW_022145601.1:16651752..16651776 21/25 Sense off-target veph1
NW_022145601.1:21873493..21873517 21/25 Antisense off-target prdm2
NW_022145601.1:3578811..3578835 21/25 Sense off-target nphp4
NW_022145601.1:4515376..4515400 21/25 Antisense off-target tmco4
NW_022145601.1:9664588..9664612 21/25 Sense off-target morn1
NW_022145602.1:15691733..15691757 21/25 Sense off-target tead1
NW_022145602.1:20925471..20925495 21/25 Antisense off-target utp20
NW_022145602.1:20929812..20929836 21/25 Antisense off-target utp20
NW_022145602.1:28430494..28430518 21/25 Antisense off-target patl1
NW_022145603.1:17552480..17552504 21/25 Sense off-target cecr2
NW_022145603.1:2466856..2466880 21/25 Sense off-target casc1
NW_022145603.1:4431258..4431282 21/25 Sense off-target apaf1
NW_022145603.1:9495668..9495692 21/25 Antisense off-target nat10
NW_022145604.1:11754517..11754541 21/25 Sense off-target abcb6
NW_022145604.1:12339970..12339994 21/25 Sense off-target cmahp
NW_022145604.1:12972086..12972110 21/25 Sense off-target trrap
NW_022145604.1:25072038..25072062 21/25 Antisense off-target itga6
NW_022145604.1:29993609..29993633 21/25 Sense off-target capn7
NW_022145604.1:6836999..6837023 21/25 Antisense off-target hprt1
NW_022145605.1:14951097..14951121 21/25 Sense off-target slx1a
NW_022145605.1:17330819..17330843 21/25 Antisense off-target ttc28
NW_022145605.1:24826021..24826045 21/25 Sense off-target thoc6
NW_022145605.1:38803778..38803802 21/25 Antisense off-target limk2
NW_022145605.1:7389215..7389239 21/25 Antisense off-target serca
NW_022145605.1:7441938..7441962 21/25 Antisense off-target serca
NW_022145606.1:46062140..46062164 21/25 Antisense off-target sfrp5
NW_022145607.1:17974296..17974320 21/25 Sense off-target shprh
NW_022145607.1:22579963..22579987 21/25 Sense off-target stk40
NW_022145607.1:27938622..27938646 21/25 Antisense off-target tex11
NW_022145607.1:33545061..33545085 21/25 Antisense off-target aadat
NW_022145607.1:40195981..40196005 21/25 Sense off-target tulp4
NW_022145607.1:35847403..35847427 21/25 Sense off-target tfb1m
NW_022145609.1:29596666..29596690 21/25 Sense off-target ipo13
NW_022145609.1:31503489..31503513 21/25 Sense off-target wdr45
NW_022145609.1:36458986..36459010 21/25 Sense off-target dock7
NW_022145609.1:39370244..39370268 21/25 Antisense off-target mknk2
NW_022145609.1:39647078..39647102 21/25 Sense off-target spef2
NW_022145610.1:12763003..12763027 21/25 Sense off-target cntrl
NW_022145610.1:22739999..22740023 21/25 Sense off-target vars1
NW_022145610.1:22774519..22774543 21/25 Antisense off-target med22
NW_022145610.1:26103692..26103716 21/25 Sense off-target prpf4
NW_022145610.1:27894286..27894310 21/25 Sense off-target edem3
NW_022145611.1:33881658..33881682 21/25 Sense off-target taf6l
NW_022145611.1:43914228..43914252 21/25 Antisense off-target parp1
NW_022145612.1:19520113..19520137 21/25 Antisense off-target lrrk2
NW_022145612.1:19533365..19533389 21/25 Antisense off-target lrrk2
NW_022145612.1:19356278..19356302 21/25 Sense off-target lrguk
NW_022145612.1:19506018..19506042 21/25 Sense off-target lrrk2
NW_022145612.1:29036197..29036221 21/25 Antisense off-target kat14
NW_022145612.1:39663192..39663216 21/25 Antisense off-target baz2b
NW_022145612.1:48628673..48628697 21/25 Antisense off-target edem1
NW_022145612.1:48107420..48107444 21/25 Antisense off-target nisch
NW_022145612.1:48311069..48311093 21/25 Antisense off-target iqca1
NW_022145613.1:13504073..13504097 21/25 Antisense off-target prpf6
NW_022145613.1:11482274..11482298 21/25 Antisense off-target smpd1
NW_022145613.1:19657329..19657353 21/25 Antisense off-target jmjd4
NW_022145613.1:23879774..23879798 21/25 Sense off-target spag1
NW_022145613.1:31332739..31332763 21/25 Sense off-target cand1
NW_022145613.1:37097395..37097419 21/25 Sense off-target dnah7
NW_022145613.1:4170385..4170409 21/25 Sense off-target kpnb1
NW_022145613.1:8834633..8834657 21/25 Sense off-target acox1
NW_022145614.1:16120079..16120103 21/25 Sense off-target gnao1
NW_022145614.1:1313191..1313215 21/25 Antisense off-target mrpl3
NW_022145614.1:20768837..20768861 21/25 Antisense off-target oplah
NW_022145614.1:27721363..27721387 21/25 Antisense off-target relch
NW_022145614.1:28996899..28996923 21/25 Sense off-target dnah5
NW_022145614.1:28524960..28524984 21/25 Antisense off-target cnot1
NW_022145614.1:9112051..9112075 21/25 Antisense off-target ndgr1
NW_022145615.1:10222878..10222902 21/25 Antisense off-target herc1
NW_022145615.1:10236038..10236062 21/25 Antisense off-target herc1
NW_022145615.1:14400323..14400347 21/25 Antisense off-target dis3l
NW_022145615.1:20003903..20003927 21/25 Sense off-target dnah8
NW_022145615.1:20853517..20853541 21/25 Sense off-target ttc37
NW_022145615.1:26013277..26013301 21/25 Sense off-target hmgcr
NW_022145615.1:32533186..32533210 21/25 Sense off-target tent2
NW_022145615.1:34142240..34142264 21/25 Sense off-target rprd2
NW_022145615.1:5454757..5454781 21/25 Sense off-target camk4
NW_022145615.1:7791425..7791449 21/25 Antisense off-target sugp1
NW_022145615.1:7838937..7838961 21/25 Antisense off-target spg21
NW_022145615.1:5027503..5027527 21/25 Sense off-target cntln
NW_022145549.1:153425..153449 21/25 Sense off-target wdr77
NW_022145594.1:17229727..17229751 21/25 Sense off-target sorl1
NW_022145595.1:11952490..11952514 21/25 Antisense off-target prkg1
NW_022145595.1:16315935..16315959 21/25 Sense off-target cpsf1
NW_022145595.1:562873..562897 21/25 Sense off-target micu1
NW_022145595.1:29211558..29211582 21/25 Sense off-target wdfy3
NW_022145596.1:1034864..1034888 21/25 Antisense off-target herc2
NW_022145596.1:12191778..12191802 21/25 Antisense off-target ccng2
NW_022145596.1:16628282..16628306 21/25 Antisense off-target nsun7
NW_022145596.1:24248495..24248519 21/25 Sense off-target brca2
NW_022145596.1:28187160..28187184 21/25 Antisense off-target wdr19
NW_022145596.1:8226510..8226534 21/25 Sense off-target pcf11
NW_022145597.1:15854314..15854338 21/25 Sense off-target nalcn
NW_022145597.1:13188837..13188861 21/25 Sense off-target dnah2
NW_022145597.1:16242385..16242409 21/25 Antisense off-target cenpi
NW_022145597.1:22363926..22363950 21/25 Antisense off-target capn5
NW_022145597.1:28148838..28148862 21/25 Sense off-target pelp1
NW_022145597.1:29877165..29877189 21/25 Sense off-target atg4b
NW_022145597.1:5911097..5911121 21/25 Antisense off-target agfg1
NW_022145607.1:34450026..34450050 24/25 Sense off-target tp53i3
NW_022145599.1:14709848..14709872 23/25 Antisense off-target chtf18
NW_022145599.1:6337258..6337282 23/25 Sense off-target mad1l1
NW_022145600.1:1331109..1331133 23/25 Antisense off-target cfap43
NW_022145602.1:6240541..6240565 23/25 Sense off-target cep290
NW_022145602.1:6696631..6696655 23/25 Antisense off-target zfc3h1
NW_022145604.1:18416180..18416204 23/25 Antisense off-target ccdc47
NW_022145609.1:28921643..28921667 23/25 Antisense off-target ranbp3
NW_022145610.1:31881676..31881700 23/25 Sense off-target nup188
NW_022145615.1:32168062..32168086 23/25 Sense off-target scaper
NW_022145595.1:24018587..24018611 23/25 Antisense off-target pcdh15
NW_022145596.1:15602228..15602252 23/25 Antisense off-target mospd2
NW_022145598.1:12557424..12557448 23/25 Antisense off-target tfap2a
NW_022145599.1:10587797..10587821 22/25 Sense off-target ankfn1
NW_022145599.1:10621506..10621530 22/25 Sense off-target ankfn1
NW_022145599.1:17730316..17730340 22/25 Sense off-target cluap1
NW_022145599.1:37068812..37068836 22/25 Antisense off-target rsl1d1
NW_022145600.1:32783748..32783772 22/25 Sense off-target cfap46
NW_022145601.1:33560978..33561002 22/25 Sense off-target klhl17
NW_022145601.1:33568475..33568499 22/25 Antisense off-target klhl17
NW_022145602.1:681070..681094 22/25 Sense off-target atp5pb
NW_022145603.1:12043175..12043199 22/25 Sense off-target kif18a
NW_022145603.1:16800224..16800248 22/25 Antisense off-target setdb1
NW_022145603.1:18483147..18483171 22/25 Antisense off-target tm7sf3
NW_022145603.1:24913992..24914016 22/25 Antisense off-target slc9c1
NW_022145603.1:23186291..23186315 22/25 Sense off-target lrriq1
NW_022145605.1:12605188..12605212 22/25 Sense off-target golga3
NW_022145605.1:16423970..16423994 22/25 Antisense off-target kif18b
NW_022145605.1:31089331..31089355 22/25 Antisense off-target hectd4
NW_022145605.1:6523179..6523203 22/25 Antisense off-target efcab5
NW_022145606.1:39819970..39819994 22/25 Antisense off-target vcpip1
NW_022145606.1:39822127..39822151 22/25 Sense off-target vcpip1
NW_022145607.1:13010382..13010406 22/25 Sense off-target map3k4
NW_022145607.1:33271670..33271694 22/25 Sense off-target arl13b
NW_022145609.1:16149109..16149133 22/25 Antisense off-target ythdc1
NW_022145609.1:11243207..11243231 22/25 Antisense off-target ndufa7
NW_022145609.1:28921313..28921337 22/25 Antisense off-target ranbp3
NW_022145609.1:37119266..37119290 22/25 Antisense off-target calret
NW_022145610.1:1097384..1097408 22/25 Sense off-target sptan1
NW_022145610.1:14536177..14536201 22/25 Antisense off-target cep350
NW_022145610.1:17532560..17532584 22/25 Antisense off-target exosc2
NW_022145610.1:27594572..27594596 22/25 Antisense off-target golga1
NW_022145611.1:12495647..12495671 22/25 Antisense off-target man2b2
NW_022145611.1:12749420..12749444 22/25 Antisense off-target lrpprc
NW_022145611.1:5265998..5266022 22/25 Sense off-target gtpbp2
NW_022145612.1:21248477..21248501 22/25 Sense off-target ptpdc1
NW_022145612.1:37472925..37472949 22/25 Sense off-target col1a2
NW_022145612.1:37487077..37487101 22/25 Sense off-target col1a2
NW_022145612.1:6241877..6241901 22/25 Antisense off-target cep152
NW_022145613.1:16925670..16925694 22/25 Sense off-target vps13b
NW_022145614.1:8659408..8659432 22/25 Sense off-target recql4
NW_022145615.1:22229070..22229094 22/25 Antisense off-target ythdc2
NW_022145615.1:26671355..26671379 22/25 Antisense off-target lrrc28
NW_022145615.1:32762544..32762568 22/25 Sense off-target mef2cl
NW_022145615.1:6757620..6757644 22/25 Antisense off-target chaf1a
NW_022145547.1:698275..698299 22/25 Antisense off-target r3hdm4
NW_022145551.1:65629..65653 22/25 Antisense off-target tmem16
NW_022145570.1:3633682..3633706 22/25 Sense off-target unc13d
NW_022145594.1:19149792..19149816 22/25 Antisense off-target nr1h4l
NW_022145594.1:29929363..29929387 22/25 Sense off-target pou2f1
NW_022145594.1:41837840..41837864 22/25 Sense off-target tomm70
NW_022145595.1:12243618..12243642 22/25 Antisense off-target polr3a
NW_022145595.1:20230359..20230383 22/25 Antisense off-target cnot6l
NW_022145595.1:5307590..5307614 22/25 Antisense off-target sec24c
NW_022145596.1:2444297..2444321 22/25 Sense off-target dnaja3
NW_022145596.1:693074..693098 22/25 Sense off-target gemin5
NW_022145597.1:20694614..20694638 22/25 Antisense off-target EGFIII
NW_022145597.1:9240162..9240186 22/25 Antisense off-target rhbdd1
NW_022145598.1:3347658..3347682 21/25 Sense off-target mrpl13
NW_022145598.1:36862733..36862757 21/25 Sense off-target rb1cc1
NW_022145599.1:14702214..14702238 21/25 Sense off-target chtf18
NW_022145600.1:17617140..17617164 21/25 Antisense off-target prom1l
NW_022145600.1:30417997..30418021 21/25 Antisense off-target anapc4
NW_022145600.1:32761294..32761318 21/25 Sense off-target cfap46
NW_022145600.1:34950031..34950055 21/25 Antisense off-target fignl1
NW_022145600.1:35761715..35761739 21/25 Antisense off-target heatr4
NW_022145602.1:27491234..27491258 21/25 Antisense off-target usp6nl
NW_022145602.1:27533452..27533476 21/25 Antisense off-target usp6nl
NW_022145602.1:29193162..29193186 21/25 Sense off-target cuedc2
NW_022145602.1:29196255..29196279 21/25 Antisense off-target cuedc2
NW_022145602.1:6243703..6243727 21/25 Sense off-target cep290
NW_022145603.1:16783971..16783995 21/25 Antisense off-target setdb1
NW_022145603.1:24917944..24917968 21/25 Antisense off-target slc9c1
NW_022145604.1:10418698..10418722 21/25 Sense off-target pkd1l1
NW_022145604.1:13635891..13635915 21/25 Antisense off-target polr1b
NW_022145604.1:18414304..18414328 21/25 Sense off-target ccdc47
NW_022145604.1:2333674..2333698 21/25 Antisense off-target golga4
NW_022145605.1:16648247..16648271 21/25 Sense off-target rad51d
NW_022145605.1:19339052..19339076 21/25 Sense off-target ggnbp2
NW_022145606.1:7919723..7919747 21/25 Antisense off-target tbc1d7
NW_022145607.1:29596577..29596601 21/25 Sense off-target polr2f
NW_022145607.1:33266752..33266776 21/25 Antisense off-target arl13b
NW_022145607.1:4486042..4486066 21/25 Sense off-target dnaaf3
NW_022145609.1:13720076..13720100 21/25 Sense off-target polr2e
NW_022145609.1:17006659..17006683 21/25 Sense off-target eif2b3
NW_022145610.1:27584265..27584289 21/25 Sense off-target golga1
NW_022145610.1:29975396..29975420 21/25 Antisense off-target fkbp15
NW_022145610.1:31464672..31464696 21/25 Sense off-target anapc5
NW_022145612.1:26411168..26411192 21/25 Sense off-target gtf3c1
NW_022145612.1:26840847..26840871 21/25 Sense off-target ncapg2
NW_022145612.1:41770701..41770725 21/25 Sense off-target washc1
NW_022145613.1:16874165..16874189 21/25 Sense off-target vps13b
NW_022145613.1:19690886..19690910 21/25 Antisense off-target ctnnb1
NW_022145614.1:10398284..10398308 21/25 Antisense off-target wrnip1
NW_022145614.1:21278986..21279010 21/25 Antisense off-target shcbp1
NW_022145614.1:30245630..30245654 21/25 Antisense off-target nudcd1
NW_022145615.1:1304743..1304767 21/25 Sense off-target iqgap1
NW_022145615.1:32176027..32176051 21/25 Antisense off-target scaper
NW_022145615.1:32211032..32211056 21/25 Antisense off-target scaper
NW_022145615.1:34198493..34198517 21/25 Antisense off-target lrrc49
NW_022145551.1:101270..101294 21/25 Antisense off-target tmem16
NW_022145551.1:47050..47074 21/25 Sense off-target tmem16
NW_022145566.1:1951909..1951933 21/25 Sense off-target znf280
NW_022145594.1:48149232..48149256 21/25 Sense off-target glb1l2
NW_022145596.1:16026032..16026056 21/25 Antisense off-target lrrc59
NW_022145596.1:1696489..1696513 21/25 Antisense off-target ppef1l
NW_022145596.1:2869517..2869541 21/25 Sense off-target txndc9
NW_022145596.1:29811239..29811263 21/25 Antisense off-target amdhd2
NW_022145602.1:835375..835399 23/25 Antisense off-target SpZ12-1
NW_022145603.1:12738245..12738269 23/25 Antisense off-target eip78cl
NW_022145604.1:10826500..10826524 23/25 Sense off-target cfap221
NW_022145604.1:25094963..25094987 23/25 Sense off-target bloc1s1
NW_022145609.1:16809468..16809492 23/25 Sense off-target slc35d1
NW_022145611.1:24465233..24465257 23/25 Sense off-target dync1h1
NW_022145595.1:22999743..22999767 23/25 Sense off-target trmt10a
NW_022145596.1:13839262..13839286 23/25 Antisense off-target dync2h1
NW_022145600.1:30968318..30968342 22/25 Antisense off-target tmem129
NW_022145601.1:3158077..3158101 22/25 Antisense off-target slc7a14
NW_022145601.1:33371732..33371756 22/25 Antisense off-target dnajc11
NW_022145601.1:4284671..4284695 22/25 Antisense off-target slc12a9
NW_022145603.1:19530719..19530743 22/25 Antisense off-target tp53i11
NW_022145604.1:2605212..2605236 22/25 Sense off-target lrrfip2
NW_022145604.1:29281850..29281874 22/25 Antisense off-target cyp20a1
NW_022145610.1:23340781..23340805 22/25 Sense off-target ppp1r10
NW_022145610.1:23611710..23611734 22/25 Sense off-target foxred1
NW_022145612.1:17439309..17439333 22/25 Sense off-target b3galt1
NW_022145612.1:50529356..50529380 22/25 Antisense off-target slc35a2
NW_022145613.1:33097891..33097915 22/25 Sense off-target ctnnal1
NW_022145613.1:34666574..34666598 22/25 Sense off-target plekha8
NW_022145614.1:24974677..24974701 22/25 Sense off-target poglut2
NW_022145572.1:636092..636116 22/25 Antisense off-target znf551l
NW_022145596.1:13844230..13844254 22/25 Sense off-target dync2h1
NW_022145597.1:7073044..7073068 22/25 Sense off-target tubgcp3
NW_022145597.1:71247..71271 22/25 Antisense off-target tmem164
NW_022145598.1:787191..787215 21/25 Sense off-target fam91a1
NW_022145598.1:795519..795543 21/25 Sense off-target fam91a1
NW_022145598.1:8401683..8401707 21/25 Sense off-target tmem244
NW_022145599.1:20593687..20593711 21/25 Antisense off-target pkdrejl
NW_022145599.1:5970489..5970513 21/25 Sense off-target cacna1g
NW_022145599.1:6019919..6019943 21/25 Sense off-target cacna1g
NW_022145600.1:24366627..24366651 21/25 Antisense off-target fam184a
NW_022145601.1:18786058..18786082 21/25 Antisense off-target znf729l
NW_022145601.1:19824163..19824187 21/25 Sense off-target ccdc150
NW_022145601.1:23179765..23179789 21/25 Antisense off-target c1orf50
NW_022145603.1:12739681..12739705 21/25 Sense off-target eip78cl
NW_022145603.1:16634152..16634176 21/25 Antisense off-target tmem41b
NW_022145603.1:23756112..23756136 21/25 Antisense off-target nr1d1l2
NW_022145603.1:23658792..23658816 21/25 Antisense off-target nr1d1l2
NW_022145604.1:5374641..5374665 21/25 Sense off-target galnt1l
NW_022145606.1:8336332..8336356 21/25 Antisense off-target tbc1d2b
NW_022145607.1:34729041..34729065 21/25 Sense off-target dpy19l3
NW_022145607.1:34734709..34734733 21/25 Sense off-target dpy19l3
NW_022145609.1:19428288..19428312 21/25 Sense off-target c5orf51
NW_022145609.1:28743721..28743745 21/25 Antisense off-target fgfr3l2
NW_022145609.1:31721396..31721420 21/25 Sense off-target slc4a11
NW_022145609.1:31662086..31662110 21/25 Antisense off-target slc4a11
NW_022145610.1:14402765..14402789 21/25 Sense off-target rapgef1
NW_022145610.1:26040441..26040465 21/25 Sense off-target zdhhc12
NW_022145610.1:33463543..33463567 21/25 Antisense off-target slc44a2
NW_022145614.1:1567775..1567799 21/25 Sense off-target tbc1d31
NW_022145614.1:13095822..13095846 21/25 Antisense off-target tmem231
NW_022145614.1:29966399..29966423 21/25 Sense off-target supt16h
NW_022145594.1:26700289..26700313 21/25 Antisense off-target tmem145
NW_022145595.1:6700481..6700505 21/25 Antisense off-target antxr1l
NW_022145596.1:32218954..32218978 21/25 Sense off-target tmem165
NW_022145597.1:18686359..18686383 21/25 Antisense off-target cxorf58
NW_022145597.1:18208051..18208075 21/25 Antisense off-target ppp2r3b
NW_022145597.1:3595085..3595109 21/25 Sense off-target atp6ap2
NW_022145607.1:35374743..35374767 23/25 Sense off-target trappc10
NW_022145599.1:13275301..13275325 22/25 Antisense off-target slc38a10
NW_022145600.1:16796461..16796485 22/25 Antisense off-target arhgap19
NW_022145602.1:9895329..9895353 22/25 Sense off-target aldh16a1
NW_022145607.1:35328394..35328418 22/25 Antisense off-target smarcad1
NW_022145610.1:9414683..9414707 22/25 Antisense off-target adamtsl2
NW_022145611.1:26098347..26098371 22/25 Sense off-target kiaa0586
NW_022145612.1:10666621..10666645 22/25 Antisense off-target timeless
NW_022145594.1:16963428..16963452 22/25 Antisense off-target zkscan3l
NW_022145594.1:25094434..25094458 22/25 Antisense off-target zscan22l
NW_022145598.1:10834559..10834583 22/25 Sense off-target c9orf135
NW_022145600.1:35769602..35769626 21/25 Antisense off-target snrnp200
NW_022145600.1:35814196..35814220 21/25 Sense off-target snrnp200
NW_022145604.1:10477523..10477547 21/25 Sense off-target slc38a11
NW_022145605.1:18418354..18418378 21/25 Antisense off-target slc5a9.7
NW_022145607.1:35334387..35334411 21/25 Sense off-target smarcad1
NW_022145594.1:25085697..25085721 21/25 Sense off-target zscan22l
NW_022145594.1:6710159..6710183 21/25 Sense off-target znf850l2
NW_022145595.1:5955158..5955182 21/25 Antisense off-target neurog2l
NW_022145603.1:13094979..13095003 24/25 Sense off-target LOC589214
NW_022145603.1:32080833..32080857 24/25 Antisense off-target LOC753216
NW_022145605.1:23907417..23907441 24/25 Sense off-target LOC588872
NW_022145612.1:55651553..55651577 24/25 Sense off-target LOC577362
NW_022145614.1:4921774..4921798 24/25 Antisense off-target LOC590159
NW_022145596.1:22508037..22508061 24/25 Sense off-target LOC590116
NW_022145597.1:16289092..16289116 24/25 Sense off-target LOC581001
NW_022145597.1:33400747..33400771 24/25 Sense off-target LOC764656
NW_022145598.1:18811729..18811753 23/25 Sense off-target LOC578626
NW_022145598.1:27415423..27415447 23/25 Sense off-target LOC753691
NW_022145598.1:35398808..35398832 23/25 Antisense off-target LOC580626
NW_022145599.1:12729080..12729104 23/25 Sense off-target LOC590908
NW_022145599.1:30993110..30993134 23/25 Sense off-target LOC579165
NW_022145599.1:31060279..31060303 23/25 Antisense off-target LOC575216
NW_022145599.1:31470207..31470231 23/25 Antisense off-target LOC757095
NW_022145599.1:31612943..31612967 23/25 Sense off-target LOC588724
NW_022145599.1:31771641..31771665 23/25 Antisense off-target LOC763490
NW_022145600.1:17031960..17031984 23/25 Antisense off-target LOC575934
NW_022145600.1:7959414..7959438 23/25 Sense off-target LOC588281
NW_022145600.1:9746046..9746070 23/25 Antisense off-target LOC578274
NW_022145601.1:10854431..10854455 23/25 Sense off-target LOC577129
NW_022145601.1:6641186..6641210 23/25 Antisense off-target LOC752737
NW_022145602.1:15275308..15275332 23/25 Sense off-target LOC576637
NW_022145602.1:4515448..4515472 23/25 Sense off-target LOC764357
NW_022145603.1:17287510..17287534 23/25 Antisense off-target LOC589715
NW_022145603.1:19275981..19276005 23/25 Antisense off-target LOC592072
NW_022145603.1:33246859..33246883 23/25 Antisense off-target LOC585060
NW_022145604.1:11379721..11379745 23/25 Antisense off-target LOC591573
NW_022145604.1:17782001..17782025 23/25 Sense off-target LOC576908
NW_022145604.1:24584473..24584497 23/25 Antisense off-target LOC764826
NW_022145604.1:9870312..9870336 23/25 Antisense off-target LOC586484
NW_022145605.1:13893382..13893406 23/25 Antisense off-target LOC593966
NW_022145605.1:14295730..14295754 23/25 Sense off-target LOC579814
NW_022145605.1:19415764..19415788 23/25 Sense off-target LOC373214
NW_022145605.1:2067436..2067460 23/25 Antisense off-target LOC585317
NW_022145605.1:40542071..40542095 23/25 Sense off-target LOC575764
NW_022145605.1:5837778..5837802 23/25 Sense off-target LOC586843
NW_022145606.1:23718911..23718935 23/25 Antisense off-target LOC580182
NW_022145606.1:33594519..33594543 23/25 Antisense off-target LOC594217
NW_022145606.1:39307678..39307702 23/25 Sense off-target LOC584058
NW_022145606.1:7897022..7897046 23/25 Antisense off-target LOC579034
NW_022145607.1:10275995..10276019 23/25 Sense off-target LOC582570
NW_022145607.1:16279104..16279128 23/25 Antisense off-target LOC584496
NW_022145607.1:3684297..3684321 23/25 Sense off-target LOC590418
NW_022145609.1:10122033..10122057 23/25 Antisense off-target LOC577309
NW_022145609.1:25419529..25419553 23/25 Sense off-target LOC589254
NW_022145609.1:31923637..31923661 23/25 Antisense off-target LOC578616
NW_022145610.1:1224086..1224110 23/25 Sense off-target LOC579317
NW_022145610.1:12266256..12266280 23/25 Antisense off-target LOC592090
NW_022145610.1:19871110..19871134 23/25 Sense off-target LOC587663
NW_022145610.1:24441003..24441027 23/25 Antisense off-target LOC592205
NW_022145610.1:34686196..34686220 23/25 Antisense off-target LOC579968
NW_022145612.1:15093901..15093925 23/25 Sense off-target LOC575234
NW_022145612.1:49049633..49049657 23/25 Antisense off-target LOC578743
NW_022145612.1:8491532..8491556 23/25 Sense off-target LOC578352
NW_022145613.1:16649496..16649520 23/25 Sense off-target LOC583305
NW_022145613.1:16942223..16942247 23/25 Antisense off-target LOC590056
NW_022145614.1:20614851..20614875 23/25 Sense off-target LOC754196
NW_022145614.1:8153749..8153773 23/25 Sense off-target LOC752300
NW_022145615.1:23925308..23925332 23/25 Sense off-target LOC575959
NW_022145615.1:25965138..25965162 23/25 Sense off-target LOC581019
NW_022145615.1:27436066..27436090 23/25 Antisense off-target LOC763088
NW_022145615.1:8590639..8590663 23/25 Sense off-target LOC581135
NW_022145516.1:1228474..1228498 23/25 Antisense off-target LOC581224
NW_022145520.1:361840..361864 23/25 Antisense off-target LOC754229
NW_022145552.1:716724..716748 23/25 Sense off-target LOC594407
NW_022145560.1:86232..86256 23/25 Sense off-target LOC756858
NW_022145561.1:392691..392715 23/25 Sense off-target LOC753802
NW_022145563.1:65945..65969 23/25 Sense off-target LOC583323
NW_022145572.1:618101..618125 23/25 Sense off-target LOC763021
NW_022145574.1:1044083..1044107 23/25 Antisense off-target LOC580810
NW_022145570.1:960042..960066 23/25 Antisense off-target LOC588563
NW_022145576.1:2719164..2719188 23/25 Antisense off-target LOC756019
NW_022145594.1:21120473..21120497 23/25 Sense off-target LOC583085
NW_022145594.1:27533715..27533739 23/25 Sense off-target LOC589676
NW_022145594.1:3960023..3960047 23/25 Sense off-target LOC585040
NW_022145594.1:39937132..39937156 23/25 Sense off-target LOC592339
NW_022145594.1:928330..928354 23/25 Antisense off-target LOC575317
NW_022145595.1:17452024..17452048 23/25 Sense off-target LOC574757
NW_022145595.1:25449044..25449068 23/25 Antisense off-target LOC579395
NW_022145595.1:5443571..5443595 23/25 Sense off-target LOC579124
NW_022145595.1:9327890..9327914 23/25 Sense off-target LOC592242
NW_022145596.1:23968298..23968322 23/25 Sense off-target LOC587664
NW_022145596.1:20085414..20085438 23/25 Antisense off-target LOC574827
NW_022145596.1:20200751..20200775 23/25 Antisense off-target LOC576655
NW_022145596.1:6374243..6374267 23/25 Antisense off-target LOC579015
NW_022145596.1:3679831..3679855 23/25 Sense off-target LOC583760
NW_022145597.1:18474115..18474139 23/25 Antisense off-target LOC763684
NW_022145597.1:19419290..19419314 23/25 Sense off-target LOC763796
NW_022145597.1:16305402..16305426 23/25 Antisense off-target LOC763344
NW_022145597.1:20772843..20772867 23/25 Sense off-target LOC582918
NW_022145597.1:19477293..19477317 23/25 Sense off-target LOC590330
NW_022145597.1:24812532..24812556 23/25 Sense off-target LOC575134
NW_022145597.1:25409759..25409783 23/25 Sense off-target LOC589419
NW_022145597.1:25433702..25433726 23/25 Sense off-target LOC589445
NW_022145597.1:28897880..28897904 23/25 Sense off-target LOC548624
NW_022145598.1:11520365..11520389 23/25 Sense off-target LOC589596
NW_022145598.1:18341862..18341886 22/25 Sense off-target LOC763209
NW_022145598.1:19767299..19767323 22/25 Antisense off-target LOC763828
NW_022145598.1:20079051..20079075 22/25 Sense off-target LOC757196
NW_022145598.1:25706360..25706384 22/25 Sense off-target LOC575038
NW_022145598.1:34727490..34727514 22/25 Antisense off-target LOC762820
NW_022145598.1:350787..350811 22/25 Sense off-target LOC591243
NW_022145598.1:36232636..36232660 22/25 Antisense off-target LOC584010
NW_022145598.1:35653955..35653979 22/25 Sense off-target LOC579122
NW_022145599.1:11425073..11425097 22/25 Sense off-target LOC579348
NW_022145599.1:11448461..11448485 22/25 Antisense off-target LOC579348
NW_022145599.1:11508292..11508316 22/25 Antisense off-target LOC578619
NW_022145599.1:12819004..12819028 22/25 Antisense off-target LOC590908
NW_022145599.1:13078778..13078802 22/25 Antisense off-target LOC575902
NW_022145599.1:14310744..14310768 22/25 Antisense off-target LOC589864
NW_022145599.1:15749697..15749721 22/25 Sense off-target LOC584770
NW_022145599.1:20825097..20825121 22/25 Antisense off-target LOC586486
NW_022145599.1:30759965..30759989 22/25 Sense off-target LOC591349
NW_022145599.1:34782775..34782799 22/25 Sense off-target LOC585875
NW_022145599.1:4770849..4770873 22/25 Antisense off-target LOC586799
NW_022145599.1:8423438..8423462 22/25 Sense off-target LOC581088
NW_022145599.1:8425168..8425192 22/25 Sense off-target LOC581088
NW_022145600.1:11306667..11306691 22/25 Sense off-target LOC576121
NW_022145600.1:18062811..18062835 22/25 Antisense off-target LOC752061
NW_022145600.1:22115450..22115474 22/25 Antisense off-target LOC575159
NW_022145600.1:30844692..30844716 22/25 Sense off-target LOC373195
NW_022145600.1:4722512..4722536 22/25 Antisense off-target LOC586584
NW_022145600.1:4909805..4909829 22/25 Sense off-target LOC584784
NW_022145600.1:4922278..4922302 22/25 Sense off-target LOC584784
NW_022145601.1:11064744..11064768 22/25 Antisense off-target LOC594771
NW_022145601.1:1117248..1117272 22/25 Antisense off-target LOC575562
NW_022145601.1:12768506..12768530 22/25 Antisense off-target LOC756696
NW_022145601.1:13295820..13295844 22/25 Antisense off-target LOC587160
NW_022145601.1:14755976..14756000 22/25 Antisense off-target LOC757060
NW_022145601.1:16104762..16104786 22/25 Sense off-target LOC755959
NW_022145601.1:18283844..18283868 22/25 Sense off-target LOC582670
NW_022145601.1:24882404..24882428 22/25 Antisense off-target LOC762614
NW_022145601.1:30018255..30018279 22/25 Antisense off-target LOC580746
NW_022145601.1:30115235..30115259 22/25 Sense off-target LOC580152
NW_022145601.1:31470453..31470477 22/25 Sense off-target LOC588274
NW_022145601.1:32001470..32001494 22/25 Antisense off-target LOC594805
NW_022145601.1:8169112..8169136 22/25 Sense off-target LOC589477
NW_022145601.1:8828223..8828247 22/25 Sense off-target LOC576875
NW_022145601.1:9878394..9878418 22/25 Sense off-target LOC590201
NW_022145601.1:6443944..6443968 22/25 Sense off-target LOC577463
NW_022145602.1:10916708..10916732 22/25 Sense off-target LOC581773
NW_022145602.1:13603547..13603571 22/25 Sense off-target LOC578203
NW_022145602.1:15312200..15312224 22/25 Sense off-target LOC576637
NW_022145602.1:15542397..15542421 22/25 Antisense off-target LOC591869
NW_022145602.1:20703748..20703772 22/25 Antisense off-target LOC589848
NW_022145602.1:23375808..23375832 22/25 Antisense off-target LOC579671
NW_022145602.1:3457049..3457073 22/25 Antisense off-target LOC584110
NW_022145602.1:568270..568294 22/25 Antisense off-target LOC583996
NW_022145602.1:5817805..5817829 22/25 Sense off-target LOC752017
NW_022145602.1:9083999..9084023 22/25 Sense off-target LOC584213
NW_022145602.1:9341985..9342009 22/25 Sense off-target LOC579303
NW_022145602.1:7116190..7116214 22/25 Antisense off-target LOC577909
NW_022145602.1:7119848..7119872 22/25 Sense off-target LOC577909
NW_022145603.1:13064599..13064623 22/25 Sense off-target LOC589214
NW_022145603.1:13452865..13452889 22/25 Antisense off-target LOC586014
NW_022145603.1:16408273..16408297 22/25 Antisense off-target LOC590639
NW_022145603.1:17288286..17288310 22/25 Sense off-target LOC589715
NW_022145603.1:17777606..17777630 22/25 Antisense off-target LOC763216
NW_022145603.1:22434177..22434201 22/25 Sense off-target LOC593558
NW_022145603.1:25015092..25015116 22/25 Sense off-target LOC764183
NW_022145603.1:25085048..25085072 22/25 Sense off-target LOC581855
NW_022145603.1:28652029..28652053 22/25 Sense off-target LOC583353
NW_022145603.1:30850895..30850919 22/25 Antisense off-target LOC579999
NW_022145603.1:33212050..33212074 22/25 Antisense off-target LOC585855
NW_022145603.1:4761849..4761873 22/25 Antisense off-target LOC586884
NW_022145603.1:8270043..8270067 22/25 Antisense off-target LOC576050
NW_022145603.1:8847267..8847291 22/25 Antisense off-target LOC756881
NW_022145603.1:8851161..8851185 22/25 Sense off-target LOC756881
NW_022145603.1:9802738..9802762 22/25 Sense off-target LOC584999
NW_022145604.1:17974677..17974701 22/25 Antisense off-target LOC576835
NW_022145604.1:1526658..1526682 22/25 Antisense off-target LOC588204
NW_022145604.1:22357437..22357461 22/25 Sense off-target LOC592613
NW_022145604.1:24603144..24603168 22/25 Sense off-target LOC764826
NW_022145604.1:26101371..26101395 22/25 Antisense off-target LOC752954
NW_022145604.1:21477142..21477166 22/25 Antisense off-target LOC589343
NW_022145604.1:26930869..26930893 22/25 Antisense off-target LOC577102
NW_022145604.1:26967046..26967070 22/25 Sense off-target LOC577102
NW_022145604.1:26497306..26497330 22/25 Antisense off-target LOC582174
NW_022145604.1:5184523..5184547 22/25 Sense off-target LOC581907
NW_022145604.1:5586242..5586266 22/25 Sense off-target LOC755000
NW_022145604.1:5832937..5832961 22/25 Antisense off-target LOC583684
NW_022145604.1:29677748..29677772 22/25 Antisense off-target LOC582782
NW_022145604.1:9817166..9817190 22/25 Sense off-target LOC586576
NW_022145605.1:12677520..12677544 22/25 Sense off-target LOC576259
NW_022145605.1:16796969..16796993 22/25 Sense off-target LOC588956
NW_022145605.1:18983267..18983291 22/25 Sense off-target LOC577163
NW_022145605.1:19042601..19042625 22/25 Antisense off-target LOC581254
NW_022145605.1:19386652..19386676 22/25 Sense off-target LOC754160
NW_022145605.1:19498617..19498641 22/25 Sense off-target LOC757057
NW_022145605.1:21429657..21429681 22/25 Antisense off-target LOC587864
NW_022145605.1:22741598..22741622 22/25 Sense off-target LOC753339
NW_022145605.1:22924203..22924227 22/25 Sense off-target LOC592927
NW_022145605.1:23015134..23015158 22/25 Antisense off-target LOC580037
NW_022145605.1:20632085..20632109 22/25 Sense off-target LOC574830
NW_022145605.1:26066686..26066710 22/25 Antisense off-target LOC585654
NW_022145605.1:27024976..27025000 22/25 Antisense off-target LOC590587
NW_022145605.1:29473991..29474015 22/25 Sense off-target LOC763713
NW_022145605.1:32107705..32107729 22/25 Sense off-target LOC592777
NW_022145605.1:37466909..37466933 22/25 Antisense off-target LOC762415
NW_022145605.1:39058509..39058533 22/25 Sense off-target LOC756453
NW_022145605.1:41602092..41602116 22/25 Sense off-target LOC583211
NW_022145605.1:41887888..41887912 22/25 Antisense off-target LOC756734
NW_022145606.1:10316702..10316726 22/25 Sense off-target LOC593779
NW_022145605.1:8053188..8053212 22/25 Antisense off-target LOC594202
NW_022145606.1:15914174..15914198 22/25 Sense off-target LOC752895
NW_022145606.1:13312052..13312076 22/25 Antisense off-target LOC764246
NW_022145606.1:23084703..23084727 22/25 Sense off-target LOC594702
NW_022145606.1:25157953..25157977 22/25 Antisense off-target LOC588152
NW_022145606.1:31809534..31809558 22/25 Sense off-target LOC574702
NW_022145606.1:31919778..31919802 22/25 Sense off-target LOC584708
NW_022145606.1:33580851..33580875 22/25 Sense off-target LOC594217
NW_022145606.1:37895732..37895756 22/25 Antisense off-target LOC577257
NW_022145606.1:41899165..41899189 22/25 Antisense off-target LOC581393
NW_022145606.1:41909970..41909994 22/25 Sense off-target LOC581393
NW_022145606.1:41956678..41956702 22/25 Antisense off-target LOC581393
NW_022145606.1:44424882..44424906 22/25 Sense off-target LOC575461
NW_022145606.1:44638492..44638516 22/25 Sense off-target LOC584276
NW_022145606.1:45728548..45728572 22/25 Sense off-target LOC593114
NW_022145606.1:45518244..45518268 22/25 Sense off-target LOC754003
NW_022145606.1:47884915..47884939 22/25 Antisense off-target LOC591850
NW_022145606.1:50297892..50297916 22/25 Sense off-target LOC578564
NW_022145606.1:7849342..7849366 22/25 Sense off-target LOC579034
NW_022145606.1:7849803..7849827 22/25 Antisense off-target LOC579034
NW_022145606.1:9574920..9574944 22/25 Sense off-target LOC578859
NW_022145606.1:9617305..9617329 22/25 Antisense off-target LOC579559
NW_022145607.1:11881172..11881196 22/25 Antisense off-target LOC591295
NW_022145607.1:12335817..12335841 22/25 Sense off-target LOC588763
NW_022145607.1:13781383..13781407 22/25 Sense off-target LOC576448
NW_022145607.1:15664003..15664027 22/25 Sense off-target LOC753999
NW_022145607.1:15890973..15890997 22/25 Sense off-target LOC591647
NW_022145607.1:14708112..14708136 22/25 Antisense off-target LOC589972
NW_022145607.1:23189018..23189042 22/25 Antisense off-target LOC755759
NW_022145607.1:19779043..19779067 22/25 Antisense off-target LOC580179
NW_022145607.1:24792783..24792807 22/25 Sense off-target LOC587692
NW_022145607.1:24879494..24879518 22/25 Sense off-target LOC581106
NW_022145607.1:30541158..30541182 22/25 Sense off-target LOC762877
NW_022145607.1:30627190..30627214 22/25 Sense off-target LOC583312
NW_022145607.1:3665779..3665803 22/25 Sense off-target LOC590418
NW_022145609.1:22129161..22129185 22/25 Sense off-target LOC752994
NW_022145609.1:22137487..22137511 22/25 Sense off-target LOC752983
NW_022145609.1:26172060..26172084 22/25 Sense off-target LOC586390
NW_022145609.1:23021408..23021432 22/25 Sense off-target LOC753562
NW_022145609.1:27218454..27218478 22/25 Sense off-target LOC579470
NW_022145609.1:26702706..26702730 22/25 Antisense off-target LOC578143
NW_022145609.1:29149027..29149051 22/25 Antisense off-target LOC757171
NW_022145609.1:31911485..31911509 22/25 Sense off-target LOC578616
NW_022145609.1:33310466..33310490 22/25 Antisense off-target LOC575168
NW_022145609.1:37141195..37141219 22/25 Sense off-target LOC591961
NW_022145609.1:37546858..37546882 22/25 Antisense off-target LOC578915
NW_022145609.1:37797053..37797077 22/25 Sense off-target LOC591734
NW_022145609.1:4733457..4733481 22/25 Sense off-target LOC591989
NW_022145609.1:5404542..5404566 22/25 Antisense off-target LOC757097
NW_022145609.1:6938976..6939000 22/25 Sense off-target LOC587426
NW_022145610.1:11919527..11919551 22/25 Sense off-target LOC755030
NW_022145610.1:13933627..13933651 22/25 Antisense off-target LOC585901
NW_022145610.1:16477259..16477283 22/25 Antisense off-target LOC582411
NW_022145610.1:18921075..18921099 22/25 Sense off-target LOC592337
NW_022145610.1:20143661..20143685 22/25 Antisense off-target LOC591276
NW_022145610.1:21671356..21671380 22/25 Sense off-target LOC756723
NW_022145610.1:24143131..24143155 22/25 Antisense off-target LOC753544
NW_022145610.1:24466410..24466434 22/25 Antisense off-target LOC592191
NW_022145610.1:4998000..4998024 22/25 Antisense off-target LOC762753
NW_022145610.1:33373483..33373507 22/25 Sense off-target LOC588147
NW_022145611.1:12498328..12498352 22/25 Sense off-target LOC579721
NW_022145611.1:15222521..15222545 22/25 Sense off-target LOC587871
NW_022145611.1:18196592..18196616 22/25 Antisense off-target LOC583607
NW_022145611.1:12495647..12495671 22/25 Sense off-target LOC579721
NW_022145611.1:22477630..22477654 22/25 Antisense off-target LOC578474
NW_022145611.1:23371537..23371561 22/25 Antisense off-target LOC591796
NW_022145611.1:25725080..25725104 22/25 Sense off-target LOC577567
NW_022145611.1:28372610..28372634 22/25 Antisense off-target LOC584503
NW_022145611.1:30534394..30534418 22/25 Antisense off-target LOC586399
NW_022145611.1:21598893..21598917 22/25 Antisense off-target LOC582896
NW_022145611.1:38567883..38567907 22/25 Antisense off-target LOC576553
NW_022145611.1:7393402..7393426 22/25 Antisense off-target LOC582192
NW_022145611.1:9252561..9252585 22/25 Antisense off-target LOC576108
NW_022145611.1:9274581..9274605 22/25 Sense off-target LOC576108
NW_022145612.1:17559880..17559904 22/25 Antisense off-target LOC577934
NW_022145612.1:22218714..22218738 22/25 Sense off-target LOC578221
NW_022145612.1:23351148..23351172 22/25 Antisense off-target LOC577145
NW_022145612.1:26303347..26303371 22/25 Antisense off-target LOC587674
NW_022145612.1:37297366..37297390 22/25 Sense off-target LOC579391
NW_022145612.1:38624468..38624492 22/25 Antisense off-target LOC587083
NW_022145612.1:39804717..39804741 22/25 Sense off-target LOC577819
NW_022145612.1:42383765..42383789 22/25 Antisense off-target LOC580806
NW_022145612.1:44121730..44121754 22/25 Sense off-target LOC594819
NW_022145612.1:56226920..56226944 22/25 Antisense off-target LOC588428
NW_022145613.1:10464355..10464379 22/25 Sense off-target LOC577113
NW_022145613.1:16821516..16821540 22/25 Antisense off-target LOC581891
NW_022145613.1:18173895..18173919 22/25 Antisense off-target LOC581039
NW_022145613.1:19415828..19415852 22/25 Antisense off-target LOC576495
NW_022145613.1:24527010..24527034 22/25 Antisense off-target LOC586157
NW_022145613.1:25141194..25141218 22/25 Antisense off-target LOC582841
NW_022145613.1:16945510..16945534 22/25 Antisense off-target LOC590056
NW_022145613.1:27077243..27077267 22/25 Antisense off-target LOC574871
NW_022145613.1:27811563..27811587 22/25 Antisense off-target LOC577353
NW_022145613.1:33823820..33823844 22/25 Sense off-target LOC587668
NW_022145613.1:34232988..34233012 22/25 Sense off-target LOC580791
NW_022145613.1:35069665..35069689 22/25 Antisense off-target LOC754420
NW_022145613.1:35076032..35076056 22/25 Sense off-target LOC754420
NW_022145613.1:5513678..5513702 22/25 Antisense off-target LOC589805
NW_022145613.1:7163014..7163038 22/25 Sense off-target LOC582025
NW_022145613.1:9025254..9025278 22/25 Sense off-target LOC578090
NW_022145613.1:9743869..9743893 22/25 Antisense off-target LOC587932
NW_022145614.1:12249116..12249140 22/25 Sense off-target LOC577249
NW_022145614.1:20614732..20614756 22/25 Antisense off-target LOC754196
NW_022145614.1:23507983..23508007 22/25 Antisense off-target LOC583807
NW_022145614.1:25296465..25296489 22/25 Antisense off-target LOC588485
NW_022145614.1:3895714..3895738 22/25 Antisense off-target LOC576617
NW_022145614.1:4607300..4607324 22/25 Antisense off-target LOC575180
NW_022145615.1:18750888..18750912 22/25 Sense off-target LOC756039
NW_022145615.1:11073893..11073917 22/25 Sense off-target LOC590671
NW_022145615.1:2207188..2207212 22/25 Antisense off-target LOC594725
NW_022145615.1:2282689..2282713 22/25 Antisense off-target LOC757285
NW_022145615.1:27435307..27435331 22/25 Antisense off-target LOC763088
NW_022145615.1:27435687..27435711 22/25 Antisense off-target LOC763088
NW_022145615.1:32698187..32698211 22/25 Sense off-target LOC587404
NW_022145615.1:33722763..33722787 22/25 Antisense off-target LOC577006
NW_022145514.1:483321..483345 22/25 Antisense off-target LOC579102
NW_022145520.1:860740..860764 22/25 Antisense off-target LOC756648
NW_022145520.1:982723..982747 22/25 Sense off-target LOC574793
NW_022145520.1:164564..164588 22/25 Antisense off-target LOC590177
NW_022145526.1:495133..495157 22/25 Antisense off-target LOC577419
NW_022145528.1:943449..943473 22/25 Sense off-target LOC591623
NW_022145528.1:476520..476544 22/25 Sense off-target LOC593978
NW_022145539.1:1482270..1482294 22/25 Sense off-target LOC591477
NW_022145539.1:173239..173263 22/25 Antisense off-target LOC582602
NW_022145539.1:1260133..1260157 22/25 Antisense off-target LOC587502
NW_022145544.1:866607..866631 22/25 Antisense off-target LOC592888
NW_022145545.1:659771..659795 22/25 Sense off-target LOC587489
NW_022145548.1:63364..63388 22/25 Antisense off-target LOC586424
NW_022145550.1:495886..495910 22/25 Sense off-target LOC587461
NW_022145550.1:68254..68278 22/25 Antisense off-target LOC578838
NW_022145552.1:773621..773645 22/25 Sense off-target LOC754104
NW_022145551.1:2376988..2377012 22/25 Antisense off-target LOC752400
NW_022145555.1:647400..647424 22/25 Antisense off-target LOC755086
NW_022145555.1:338349..338373 22/25 Sense off-target LOC581718
NW_022145558.1:420486..420510 22/25 Antisense off-target LOC591603
NW_022145558.1:860048..860072 22/25 Antisense off-target LOC580387
NW_022145563.1:213493..213517 22/25 Antisense off-target LOC575556
NW_022145563.1:389776..389800 22/25 Sense off-target LOC576734
NW_022145570.1:1119795..1119819 22/25 Sense off-target LOC373215
NW_022145566.1:838768..838792 22/25 Sense off-target LOC578074
NW_022145566.1:871760..871784 22/25 Sense off-target LOC578128
NW_022145567.1:602740..602764 22/25 Antisense off-target LOC590091
NW_022145570.1:628737..628761 22/25 Sense off-target LOC575057
NW_022145570.1:665440..665464 22/25 Antisense off-target LOC588555
NW_022145576.1:201151..201175 22/25 Antisense off-target LOC585218
NW_022145576.1:232610..232634 22/25 Antisense off-target LOC585218
NW_022145578.1:587090..587114 22/25 Sense off-target LOC575861
NW_022145594.1:17074476..17074500 22/25 Sense off-target LOC763122
NW_022145594.1:23373142..23373166 22/25 Antisense off-target LOC577692
NW_022145594.1:26785189..26785213 22/25 Antisense off-target LOC584848
NW_022145594.1:2518148..2518172 22/25 Sense off-target LOC755739
NW_022145594.1:25387012..25387036 22/25 Sense off-target LOC590756
NW_022145594.1:32954049..32954073 22/25 Sense off-target LOC762799
NW_022145594.1:32971166..32971190 22/25 Sense off-target LOC762799
NW_022145594.1:37465697..37465721 22/25 Antisense off-target LOC583230
NW_022145594.1:33823348..33823372 22/25 Antisense off-target LOC576882
NW_022145594.1:42547701..42547725 22/25 Antisense off-target LOC592552
NW_022145594.1:46410663..46410687 22/25 Sense off-target LOC753366
NW_022145594.1:51008594..51008618 22/25 Sense off-target LOC585010
NW_022145594.1:5117044..5117068 22/25 Sense off-target LOC585963
NW_022145595.1:1221087..1221111 22/25 Antisense off-target LOC594735
NW_022145595.1:20343413..20343437 22/25 Antisense off-target LOC578540
NW_022145595.1:14512382..14512406 22/25 Sense off-target LOC584490
NW_022145595.1:15108702..15108726 22/25 Antisense off-target LOC591888
NW_022145595.1:22197281..22197305 22/25 Sense off-target LOC581825
NW_022145595.1:2235610..2235634 22/25 Sense off-target LOC583527
NW_022145595.1:5875560..5875584 22/25 Antisense off-target LOC580598
NW_022145595.1:28365206..28365230 22/25 Sense off-target LOC584983
NW_022145595.1:29574776..29574800 22/25 Antisense off-target LOC584015
NW_022145595.1:4073662..4073686 22/25 Sense off-target LOC585077
NW_022145595.1:9322335..9322359 22/25 Antisense off-target LOC592242
NW_022145596.1:10331984..10332008 22/25 Sense off-target LOC590676
NW_022145595.1:8562236..8562260 22/25 Antisense off-target LOC576280
NW_022145595.1:9075127..9075151 22/25 Antisense off-target LOC578468
NW_022145596.1:10780840..10780864 22/25 Sense off-target LOC590319
NW_022145596.1:11081979..11082003 22/25 Antisense off-target LOC592122
NW_022145596.1:11861781..11861805 22/25 Sense off-target LOC577084
NW_022145596.1:11878452..11878476 22/25 Sense off-target LOC577084
NW_022145596.1:19846618..19846642 22/25 Sense off-target LOC583205
NW_022145596.1:26273939..26273963 22/25 Sense off-target LOC591782
NW_022145596.1:30163646..30163670 22/25 Antisense off-target LOC764891
NW_022145596.1:6360029..6360053 22/25 Antisense off-target LOC579015
NW_022145597.1:11379181..11379205 22/25 Antisense off-target LOC753724
NW_022145596.1:8028116..8028140 22/25 Sense off-target LOC575200
NW_022145596.1:8162396..8162420 22/25 Antisense off-target LOC581076
NW_022145596.1:8166335..8166359 22/25 Sense off-target LOC581076
NW_022145596.1:8185481..8185505 22/25 Sense off-target LOC581076
NW_022145597.1:13982619..13982643 22/25 Sense off-target LOC579053
NW_022145597.1:11612278..11612302 22/25 Sense off-target LOC592126
NW_022145597.1:19914098..19914122 22/25 Antisense off-target LOC582287
NW_022145597.1:20777954..20777978 22/25 Antisense off-target LOC582918
NW_022145597.1:19471711..19471735 22/25 Antisense off-target LOC590330
NW_022145597.1:19719755..19719779 22/25 Sense off-target LOC584095
NW_022145597.1:22425783..22425807 22/25 Sense off-target LOC592256
NW_022145597.1:22875745..22875769 22/25 Antisense off-target LOC592453
NW_022145597.1:22942404..22942428 22/25 Sense off-target LOC583829
NW_022145597.1:23567906..23567930 22/25 Sense off-target LOC754694
NW_022145597.1:23855149..23855173 22/25 Antisense off-target LOC587687
NW_022145597.1:27458393..27458417 22/25 Sense off-target LOC586726
NW_022145597.1:27458937..27458961 22/25 Sense off-target LOC586726
NW_022145597.1:28578098..28578122 22/25 Antisense off-target LOC592465
NW_022145597.1:29318940..29318964 22/25 Sense off-target LOC583024
NW_022145597.1:5535859..5535883 22/25 Antisense off-target LOC587438
NW_022145597.1:6550380..6550404 22/25 Sense off-target LOC591575
NW_022145597.1:7214097..7214121 22/25 Sense off-target LOC590257
NW_022145597.1:8120330..8120354 22/25 Antisense off-target LOC578391
NW_022145597.1:8849138..8849162 22/25 Antisense off-target LOC594581
NW_022145598.1:10068867..10068891 22/25 Antisense off-target LOC594091
NW_022145598.1:18038993..18039017 21/25 Antisense off-target LOC592086
NW_022145598.1:18156255..18156279 21/25 Antisense off-target LOC589571
NW_022145598.1:18359000..18359024 21/25 Antisense off-target LOC763209
NW_022145598.1:18848000..18848024 21/25 Sense off-target LOC578626
NW_022145598.1:22723602..22723626 21/25 Sense off-target LOC584440
NW_022145598.1:19831886..19831910 21/25 Antisense off-target LOC579947
NW_022145598.1:20076759..20076783 21/25 Antisense off-target LOC757196
NW_022145598.1:25414328..25414352 21/25 Antisense off-target LOC580497
NW_022145598.1:27481449..27481473 21/25 Antisense off-target LOC586898
NW_022145598.1:24223425..24223449 21/25 Sense off-target LOC576586
NW_022145598.1:32406918..32406942 21/25 Sense off-target LOC591775
NW_022145598.1:36100586..36100610 21/25 Sense off-target LOC593243
NW_022145598.1:36730891..36730915 21/25 Antisense off-target LOC582503
NW_022145598.1:35666170..35666194 21/25 Antisense off-target LOC764103
NW_022145598.1:35835315..35835339 21/25 Antisense off-target LOC584813
NW_022145598.1:36953597..36953621 21/25 Antisense off-target LOC587950
NW_022145598.1:8627101..8627125 21/25 Sense off-target LOC756176
NW_022145598.1:9047156..9047180 21/25 Sense off-target LOC592680
NW_022145599.1:12011316..12011340 21/25 Sense off-target LOC577336
NW_022145599.1:13080619..13080643 21/25 Sense off-target LOC575902
NW_022145599.1:15524989..15525013 21/25 Sense off-target LOC576125
NW_022145599.1:15733680..15733704 21/25 Sense off-target LOC584770
NW_022145599.1:15749446..15749470 21/25 Sense off-target LOC584770
NW_022145599.1:16065559..16065583 21/25 Sense off-target LOC757176
NW_022145599.1:16262206..16262230 21/25 Antisense off-target LOC590002
NW_022145599.1:16263871..16263895 21/25 Antisense off-target LOC590002
NW_022145599.1:18427251..18427275 21/25 Antisense off-target LOC580674
NW_022145599.1:18429400..18429424 21/25 Antisense off-target LOC580674
NW_022145599.1:20809483..20809507 21/25 Antisense off-target LOC586486
NW_022145599.1:21700894..21700918 21/25 Antisense off-target LOC762525
NW_022145599.1:29047894..29047918 21/25 Antisense off-target LOC594146
NW_022145599.1:31468773..31468797 21/25 Antisense off-target LOC757095
NW_022145599.1:31881844..31881868 21/25 Sense off-target LOC373213
NW_022145599.1:31935969..31935993 21/25 Antisense off-target LOC762517
NW_022145599.1:34757375..34757399 21/25 Sense off-target LOC585875
NW_022145599.1:36486843..36486867 21/25 Antisense off-target LOC588719
NW_022145600.1:10604258..10604282 21/25 Sense off-target LOC591592
NW_022145600.1:13283027..13283051 21/25 Sense off-target LOC752960
NW_022145600.1:13913542..13913566 21/25 Antisense off-target LOC586365
NW_022145600.1:14052482..14052506 21/25 Antisense off-target LOC574954
NW_022145600.1:18488520..18488544 21/25 Antisense off-target LOC763292
NW_022145600.1:18503172..18503196 21/25 Sense off-target LOC763292
NW_022145600.1:20267260..20267284 21/25 Antisense off-target LOC762451
NW_022145600.1:219657..219681 21/25 Sense off-target LOC577629
NW_022145600.1:22010379..22010403 21/25 Antisense off-target LOC575014
NW_022145600.1:22488652..22488676 21/25 Sense off-target LOC592945
NW_022145600.1:23677035..23677059 21/25 Sense off-target LOC763091
NW_022145600.1:24289983..24290007 21/25 Sense off-target LOC583124
NW_022145600.1:27070969..27070993 21/25 Antisense off-target LOC590398
NW_022145600.1:27694116..27694140 21/25 Sense off-target LOC764218
NW_022145600.1:29331480..29331504 21/25 Antisense off-target LOC756946
NW_022145600.1:29617867..29617891 21/25 Antisense off-target LOC591301
NW_022145600.1:31041205..31041229 21/25 Sense off-target LOC575097
NW_022145600.1:32034205..32034229 21/25 Sense off-target LOC578182
NW_022145600.1:34679752..34679776 21/25 Antisense off-target LOC575549
NW_022145600.1:35678098..35678122 21/25 Antisense off-target LOC762712
NW_022145600.1:4721575..4721599 21/25 Antisense off-target LOC586584
NW_022145600.1:5176913..5176937 21/25 Antisense off-target LOC754030
NW_022145600.1:6680106..6680130 21/25 Antisense off-target LOC580192
NW_022145600.1:7235381..7235405 21/25 Antisense off-target LOC590069
NW_022145600.1:4694570..4694594 21/25 Antisense off-target LOC586560
NW_022145600.1:8595302..8595326 21/25 Antisense off-target LOC575645
NW_022145600.1:9755022..9755046 21/25 Sense off-target LOC578274
NW_022145601.1:10529620..10529644 21/25 Antisense off-target LOC581322
NW_022145601.1:1072754..1072778 21/25 Sense off-target LOC575562
NW_022145601.1:12674641..12674665 21/25 Antisense off-target LOC584552
NW_022145601.1:16196428..16196452 21/25 Sense off-target LOC587527
NW_022145601.1:18597413..18597437 21/25 Antisense off-target LOC756959
NW_022145601.1:19443415..19443439 21/25 Sense off-target LOC590203
NW_022145601.1:19913826..19913850 21/25 Antisense off-target LOC578101
NW_022145601.1:24075959..24075983 21/25 Antisense off-target LOC593523
NW_022145601.1:25086387..25086411 21/25 Antisense off-target LOC579256
NW_022145601.1:28031034..28031058 21/25 Sense off-target LOC576735
NW_022145601.1:32011085..32011109 21/25 Sense off-target LOC594805
NW_022145601.1:33771579..33771603 21/25 Antisense off-target LOC756461
NW_022145601.1:6404458..6404482 21/25 Antisense off-target LOC588097
NW_022145601.1:33302459..33302483 21/25 Antisense off-target LOC764563
NW_022145601.1:7170372..7170396 21/25 Sense off-target LOC753159
NW_022145601.1:7852642..7852666 21/25 Antisense off-target LOC578967
NW_022145601.1:9859257..9859281 21/25 Sense off-target LOC590201
NW_022145602.1:10939774..10939798 21/25 Antisense off-target LOC590502
NW_022145602.1:1050741..1050765 21/25 Sense off-target LOC753367
NW_022145602.1:13715285..13715309 21/25 Antisense off-target LOC578203
NW_022145602.1:13740706..13740730 21/25 Sense off-target LOC578203
NW_022145602.1:15029511..15029535 21/25 Sense off-target LOC575241
NW_022145602.1:15587185..15587209 21/25 Sense off-target LOC586879
NW_022145602.1:15368619..15368643 21/25 Sense off-target LOC588077
NW_022145602.1:26047102..26047126 21/25 Antisense off-target LOC589483
NW_022145602.1:4494952..4494976 21/25 Antisense off-target LOC764357
NW_022145602.1:28078146..28078170 21/25 Sense off-target LOC764423
NW_022145602.1:6439830..6439854 21/25 Antisense off-target LOC580415
NW_022145602.1:6824672..6824696 21/25 Sense off-target LOC586585
NW_022145602.1:9086955..9086979 21/25 Sense off-target LOC584213
NW_022145603.1:13477841..13477865 21/25 Antisense off-target LOC593113
NW_022145603.1:16440796..16440820 21/25 Sense off-target LOC586734
NW_022145603.1:19621651..19621675 21/25 Sense off-target LOC576805
NW_022145603.1:21433136..21433160 21/25 Sense off-target LOC373362
NW_022145603.1:21754331..21754355 21/25 Sense off-target LOC594151
NW_022145603.1:21969144..21969168 21/25 Antisense off-target LOC582350
NW_022145603.1:19072095..19072119 21/25 Antisense off-target LOC751836
NW_022145603.1:23878912..23878936 21/25 Sense off-target LOC576174
NW_022145603.1:2401212..2401236 21/25 Sense off-target LOC574986
NW_022145603.1:2421056..2421080 21/25 Antisense off-target LOC574986
NW_022145603.1:30208552..30208576 21/25 Sense off-target LOC581383
NW_022145603.1:31587841..31587865 21/25 Sense off-target LOC592232
NW_022145603.1:32074056..32074080 21/25 Sense off-target LOC753216
NW_022145603.1:26483859..26483883 21/25 Antisense off-target LOC584160
NW_022145603.1:26856646..26856670 21/25 Sense off-target LOC579912
NW_022145603.1:33264035..33264059 21/25 Sense off-target LOC585060
NW_022145603.1:34113656..34113680 21/25 Sense off-target LOC582973
NW_022145603.1:34127670..34127694 21/25 Sense off-target LOC582973
NW_022145603.1:4773325..4773349 21/25 Antisense off-target LOC586884
NW_022145603.1:33142290..33142314 21/25 Sense off-target LOC589459
NW_022145603.1:33151677..33151701 21/25 Sense off-target LOC589459
NW_022145603.1:8017672..8017696 21/25 Antisense off-target LOC593450
NW_022145603.1:8433721..8433745 21/25 Sense off-target LOC577198
NW_022145603.1:9425425..9425449 21/25 Sense off-target LOC576563
NW_022145603.1:7081522..7081546 21/25 Antisense off-target LOC586217
NW_022145604.1:10651330..10651354 21/25 Antisense off-target LOC762602
NW_022145604.1:10147519..10147543 21/25 Antisense off-target LOC764556
NW_022145604.1:13031468..13031492 21/25 Antisense off-target LOC765039
NW_022145604.1:14632269..14632293 21/25 Sense off-target LOC592201
NW_022145604.1:14769710..14769734 21/25 Antisense off-target LOC581285
NW_022145604.1:1855874..1855898 21/25 Antisense off-target LOC577797
NW_022145604.1:20553028..20553052 21/25 Antisense off-target LOC373223
NW_022145604.1:20590572..20590596 21/25 Sense off-target LOC582521
NW_022145604.1:22503619..22503643 21/25 Antisense off-target LOC592390
NW_022145604.1:27609968..27609992 21/25 Sense off-target LOC752810
NW_022145604.1:3162531..3162555 21/25 Sense off-target LOC577380
NW_022145604.1:6587705..6587729 21/25 Sense off-target LOC585404
NW_022145604.1:8276988..8277012 21/25 Sense off-target LOC373178
NW_022145604.1:8914111..8914135 21/25 Sense off-target LOC581905
NW_022145604.1:5833311..5833335 21/25 Sense off-target LOC583684
NW_022145604.1:6416638..6416662 21/25 Sense off-target LOC593247
NW_022145605.1:11544761..11544785 21/25 Sense off-target LOC590207
NW_022145605.1:12865081..12865105 21/25 Sense off-target LOC593174
NW_022145605.1:13033791..13033815 21/25 Antisense off-target LOC762514
NW_022145605.1:10564601..10564625 21/25 Sense off-target LOC578834
NW_022145605.1:11540825..11540849 21/25 Sense off-target LOC590207
NW_022145605.1:14631453..14631477 21/25 Antisense off-target LOC592398
NW_022145605.1:19093186..19093210 21/25 Sense off-target LOC373512
NW_022145605.1:19544802..19544826 21/25 Sense off-target LOC753686
NW_022145605.1:20061284..20061308 21/25 Antisense off-target LOC763956
NW_022145605.1:22898564..22898588 21/25 Antisense off-target LOC592927
NW_022145605.1:23796273..23796297 21/25 Antisense off-target LOC582089
NW_022145605.1:24318248..24318272 21/25 Antisense off-target LOC764716
NW_022145605.1:26245822..26245846 21/25 Antisense off-target LOC581752
NW_022145605.1:27017796..27017820 21/25 Antisense off-target LOC590587
NW_022145605.1:37869521..37869545 21/25 Antisense off-target LOC588253
NW_022145605.1:41964589..41964613 21/25 Antisense off-target LOC580739
NW_022145605.1:4355505..4355529 21/25 Antisense off-target LOC590648
NW_022145605.1:6849150..6849174 21/25 Sense off-target LOC584382
NW_022145605.1:7306255..7306279 21/25 Antisense off-target LOC592634
NW_022145605.1:40856201..40856225 21/25 Antisense off-target LOC583423
NW_022145606.1:11666970..11666994 21/25 Antisense off-target LOC576067
NW_022145606.1:11839986..11840010 21/25 Antisense off-target LOC593835
NW_022145606.1:14128521..14128545 21/25 Sense off-target LOC590619
NW_022145606.1:19151743..19151767 21/25 Sense off-target LOC594632
NW_022145606.1:14072742..14072766 21/25 Antisense off-target LOC579693
NW_022145606.1:23143078..23143102 21/25 Sense off-target LOC579315
NW_022145606.1:25242532..25242556 21/25 Antisense off-target LOC588152
NW_022145606.1:28182782..28182806 21/25 Antisense off-target LOC584931
NW_022145606.1:28970240..28970264 21/25 Sense off-target LOC591077
NW_022145606.1:25214518..25214542 21/25 Antisense off-target LOC588152
NW_022145606.1:32408781..32408805 21/25 Sense off-target LOC594372
NW_022145606.1:32797270..32797294 21/25 Antisense off-target LOC763845
NW_022145606.1:35979026..35979050 21/25 Antisense off-target LOC594361
NW_022145606.1:35981533..35981557 21/25 Sense off-target LOC594361
NW_022145606.1:35984857..35984881 21/25 Sense off-target LOC594361
NW_022145606.1:36058010..36058034 21/25 Sense off-target LOC594361
NW_022145606.1:38271514..38271538 21/25 Sense off-target LOC590749
NW_022145606.1:41914354..41914378 21/25 Sense off-target LOC581393
NW_022145606.1:41993841..41993865 21/25 Antisense off-target LOC581219
NW_022145606.1:43471692..43471716 21/25 Sense off-target LOC590634
NW_022145606.1:44264244..44264268 21/25 Antisense off-target LOC591824
NW_022145606.1:44649829..44649853 21/25 Sense off-target LOC584260
NW_022145606.1:43852903..43852927 21/25 Antisense off-target LOC576830
NW_022145606.1:45723517..45723541 21/25 Antisense off-target LOC593114
NW_022145606.1:46954009..46954033 21/25 Antisense off-target LOC588795
NW_022145606.1:47284511..47284535 21/25 Antisense off-target LOC752556
NW_022145606.1:47295362..47295386 21/25 Antisense off-target LOC752556
NW_022145606.1:47309111..47309135 21/25 Sense off-target LOC752556
NW_022145606.1:45446824..45446848 21/25 Sense off-target LOC593726
NW_022145606.1:47895647..47895671 21/25 Antisense off-target LOC763133
NW_022145606.1:48254183..48254207 21/25 Antisense off-target LOC580489
NW_022145606.1:48460034..48460058 21/25 Antisense off-target LOC584387
NW_022145606.1:47318166..47318190 21/25 Sense off-target LOC752556
NW_022145606.1:9847893..9847917 21/25 Sense off-target LOC583090
NW_022145607.1:12514252..12514276 21/25 Sense off-target LOC589042
NW_022145607.1:15549634..15549658 21/25 Sense off-target LOC593255
NW_022145607.1:15505010..15505034 21/25 Antisense off-target LOC584375
NW_022145607.1:21810036..21810060 21/25 Antisense off-target LOC588895
NW_022145607.1:23285018..23285042 21/25 Sense off-target LOC584441
NW_022145607.1:19268567..19268591 21/25 Antisense off-target LOC765070
NW_022145607.1:24993181..24993205 21/25 Sense off-target LOC577132
NW_022145607.1:25085966..25085990 21/25 Sense off-target LOC576747
NW_022145607.1:27158180..27158204 21/25 Antisense off-target LOC582980
NW_022145607.1:27583961..27583985 21/25 Antisense off-target LOC754026
NW_022145607.1:28514719..28514743 21/25 Antisense off-target LOC754172
NW_022145607.1:31100771..31100795 21/25 Antisense off-target LOC575350
NW_022145607.1:28235285..28235309 21/25 Sense off-target LOC592824
NW_022145607.1:3397677..3397701 21/25 Sense off-target LOC588572
NW_022145607.1:32634465..32634489 21/25 Sense off-target LOC593546
NW_022145607.1:3271993..3272017 21/25 Antisense off-target LOC580608
NW_022145607.1:37015705..37015729 21/25 Sense off-target LOC577805
NW_022145607.1:39419342..39419366 21/25 Antisense off-target LOC577455
NW_022145607.1:4051418..4051442 21/25 Antisense off-target LOC584569
NW_022145607.1:3658036..3658060 21/25 Sense off-target LOC590418
NW_022145607.1:41830957..41830981 21/25 Antisense off-target LOC579310
NW_022145607.1:9583947..9583971 21/25 Sense off-target LOC762994
NW_022145609.1:14834769..14834793 21/25 Antisense off-target LOC585698
NW_022145609.1:23292689..23292713 21/25 Antisense off-target LOC576785
NW_022145609.1:23650702..23650726 21/25 Sense off-target LOC575585
NW_022145609.1:25976499..25976523 21/25 Antisense off-target LOC583924
NW_022145609.1:26484754..26484778 21/25 Sense off-target LOC587488
NW_022145609.1:26675919..26675943 21/25 Sense off-target LOC578092
NW_022145609.1:27276112..27276136 21/25 Sense off-target LOC580769
NW_022145609.1:28735586..28735610 21/25 Antisense off-target LOC578436
NW_022145609.1:29468157..29468181 21/25 Antisense off-target LOC580904
NW_022145609.1:30283382..30283406 21/25 Antisense off-target LOC591902
NW_022145609.1:28887001..28887025 21/25 Antisense off-target LOC584383
NW_022145609.1:33307238..33307262 21/25 Sense off-target LOC575168
NW_022145609.1:33310852..33310876 21/25 Sense off-target LOC575168
NW_022145609.1:36530791..36530815 21/25 Antisense off-target LOC576707
NW_022145609.1:37065216..37065240 21/25 Antisense off-target LOC576159
NW_022145609.1:38267039..38267063 21/25 Sense off-target LOC756393
NW_022145609.1:5521964..5521988 21/25 Antisense off-target LOC590093
NW_022145609.1:5522113..5522137 21/25 Antisense off-target LOC590093
NW_022145609.1:7922092..7922116 21/25 Sense off-target LOC578045
NW_022145609.1:9243434..9243458 21/25 Sense off-target LOC589328
NW_022145610.1:10635151..10635175 21/25 Sense off-target LOC591001
NW_022145610.1:11537330..11537354 21/25 Sense off-target LOC574854
NW_022145610.1:11842076..11842100 21/25 Sense off-target LOC754949
NW_022145609.1:9836158..9836182 21/25 Antisense off-target LOC589888
NW_022145610.1:1347816..1347840 21/25 Antisense off-target LOC575436
NW_022145610.1:13762210..13762234 21/25 Sense off-target LOC589158
NW_022145610.1:15419702..15419726 21/25 Sense off-target LOC587881
NW_022145610.1:12485986..12486010 21/25 Sense off-target LOC586433
NW_022145610.1:16111478..16111502 21/25 Antisense off-target LOC576471
NW_022145610.1:16483606..16483630 21/25 Sense off-target LOC582411
NW_022145610.1:19868913..19868937 21/25 Antisense off-target LOC587663
NW_022145610.1:22576430..22576454 21/25 Sense off-target LOC754422
NW_022145610.1:18857033..18857057 21/25 Sense off-target LOC592161
NW_022145610.1:18912589..18912613 21/25 Antisense off-target LOC592337
NW_022145610.1:23111498..23111522 21/25 Antisense off-target LOC576500
NW_022145610.1:33178712..33178736 21/25 Antisense off-target LOC590125
NW_022145610.1:7339976..7340000 21/25 Sense off-target LOC762398
NW_022145610.1:7344165..7344189 21/25 Sense off-target LOC762398
NW_022145610.1:33187213..33187237 21/25 Sense off-target LOC590125
NW_022145611.1:15802070..15802094 21/25 Sense off-target LOC580673
NW_022145611.1:17493771..17493795 21/25 Antisense off-target LOC588883
NW_022145611.1:18605851..18605875 21/25 Antisense off-target LOC574609
NW_022145611.1:24699222..24699246 21/25 Sense off-target LOC577801
NW_022145611.1:29523298..29523322 21/25 Antisense off-target LOC575977
NW_022145611.1:32415877..32415901 21/25 Antisense off-target LOC592633
NW_022145611.1:36843180..36843204 21/25 Antisense off-target LOC756678
NW_022145611.1:39007062..39007086 21/25 Sense off-target LOC592743
NW_022145611.1:41253587..41253611 21/25 Sense off-target LOC754879
NW_022145611.1:43870225..43870249 21/25 Antisense off-target LOC592207
NW_022145611.1:31200371..31200395 21/25 Antisense off-target TRNAV-CAC
NW_022145611.1:5829082..5829106 21/25 Antisense off-target LOC763525
NW_022145611.1:5847957..5847981 21/25 Antisense off-target LOC763525
NW_022145611.1:6242655..6242679 21/25 Antisense off-target LOC580086
NW_022145611.1:6249396..6249420 21/25 Antisense off-target LOC580086
NW_022145612.1:10891445..10891469 21/25 Sense off-target LOC582715
NW_022145612.1:1459201..1459225 21/25 Sense off-target LOC586628
NW_022145612.1:15678145..15678169 21/25 Sense off-target LOC580842
NW_022145612.1:17186251..17186275 21/25 Antisense off-target LOC581523
NW_022145612.1:20392290..20392314 21/25 Antisense off-target LOC582318
NW_022145612.1:23119199..23119223 21/25 Sense off-target LOC575613
NW_022145612.1:18736935..18736959 21/25 Sense off-target LOC588819
NW_022145612.1:26208967..26208991 21/25 Antisense off-target LOC588038
NW_022145612.1:26709335..26709359 21/25 Antisense off-target LOC583129
NW_022145612.1:26813254..26813278 21/25 Antisense off-target LOC589386
NW_022145612.1:27097967..27097991 21/25 Sense off-target LOC580994
NW_022145612.1:27190691..27190715 21/25 Antisense off-target LOC581820
NW_022145612.1:25090005..25090029 21/25 Sense off-target LOC592899
NW_022145612.1:28843003..28843027 21/25 Sense off-target LOC575215
NW_022145612.1:30139556..30139580 21/25 Antisense off-target LOC582206
NW_022145612.1:28240008..28240032 21/25 Antisense off-target LOC581656
NW_022145612.1:38880508..38880532 21/25 Sense off-target LOC752101
NW_022145612.1:39870738..39870762 21/25 Antisense off-target LOC577570
NW_022145612.1:40224047..40224071 21/25 Sense off-target LOC577640
NW_022145612.1:40934573..40934597 21/25 Sense off-target LOC762418
NW_022145612.1:42522644..42522668 21/25 Sense off-target LOC591054
NW_022145612.1:43249123..43249147 21/25 Sense off-target LOC576434
NW_022145612.1:44407109..44407133 21/25 Sense off-target LOC763141
NW_022145612.1:46423679..46423703 21/25 Sense off-target LOC584806
NW_022145612.1:47052408..47052432 21/25 Sense off-target LOC581821
NW_022145612.1:42036920..42036944 21/25 Antisense off-target LOC589849
NW_022145612.1:42056766..42056790 21/25 Antisense off-target LOC755518
NW_022145612.1:50452907..50452931 21/25 Sense off-target LOC755928
NW_022145612.1:54275671..54275695 21/25 Sense off-target LOC575335
NW_022145613.1:13482501..13482525 21/25 Antisense off-target LOC593680
NW_022145613.1:15074701..15074725 21/25 Sense off-target LOC754769
NW_022145613.1:15089606..15089630 21/25 Sense off-target LOC754769
NW_022145613.1:21996807..21996831 21/25 Antisense off-target LOC755589
NW_022145613.1:23637528..23637552 21/25 Antisense off-target LOC575943
NW_022145613.1:23771100..23771124 21/25 Antisense off-target LOC575982
NW_022145613.1:2473613..2473637 21/25 Antisense off-target LOC593493
NW_022145613.1:27062844..27062868 21/25 Antisense off-target LOC574871
NW_022145613.1:35998337..35998361 21/25 Antisense off-target LOC590964
NW_022145613.1:5130614..5130638 21/25 Sense off-target LOC755114
NW_022145613.1:7203395..7203419 21/25 Sense off-target LOC589670
NW_022145613.1:7448655..7448679 21/25 Sense off-target LOC586137
NW_022145613.1:9764654..9764678 21/25 Sense off-target LOC592705
NW_022145614.1:1043617..1043641 21/25 Sense off-target LOC576494
NW_022145614.1:12129261..12129285 21/25 Sense off-target LOC592585
NW_022145614.1:12349242..12349266 21/25 Sense off-target LOC576962
NW_022145614.1:12359667..12359691 21/25 Antisense off-target LOC576962
NW_022145614.1:17969744..17969768 21/25 Antisense off-target LOC576126
NW_022145614.1:12922179..12922203 21/25 Sense off-target LOC590013
NW_022145614.1:19058150..19058174 21/25 Antisense off-target LOC594100
NW_022145614.1:1922847..1922871 21/25 Sense off-target LOC577690
NW_022145614.1:26911524..26911548 21/25 Antisense off-target LOC577086
NW_022145614.1:27174230..27174254 21/25 Sense off-target LOC577327
NW_022145614.1:23942225..23942249 21/25 Antisense off-target LOC576233
NW_022145614.1:4485261..4485285 21/25 Antisense off-target LOC752270
NW_022145614.1:8111766..8111790 21/25 Antisense off-target LOC752300
NW_022145615.1:10301837..10301861 21/25 Sense off-target LOC581877
NW_022145614.1:6016118..6016142 21/25 Sense off-target LOC575096
NW_022145615.1:17507513..17507537 21/25 Sense off-target LOC575553
NW_022145615.1:21956689..21956713 21/25 Antisense off-target LOC578960
NW_022145615.1:22100242..22100266 21/25 Sense off-target LOC578529
NW_022145615.1:22736858..22736882 21/25 Antisense off-target LOC764935
NW_022145615.1:23939753..23939777 21/25 Antisense off-target LOC575959
NW_022145615.1:24103232..24103256 21/25 Sense off-target LOC763789
NW_022145615.1:26540876..26540900 21/25 Antisense off-target LOC589697
NW_022145615.1:26555134..26555158 21/25 Sense off-target LOC589697
NW_022145615.1:26561266..26561290 21/25 Sense off-target LOC589697
NW_022145615.1:27933770..27933794 21/25 Antisense off-target LOC580976
NW_022145615.1:27934151..27934175 21/25 Antisense off-target LOC580976
NW_022145615.1:31420653..31420677 21/25 Antisense off-target LOC592418
NW_022145615.1:8578147..8578171 21/25 Antisense off-target LOC581074
NW_022145615.1:972165..972189 21/25 Antisense off-target LOC574669
NW_022145615.1:985425..985449 21/25 Antisense off-target LOC574669
NW_022145615.1:3672397..3672421 21/25 Sense off-target LOC764044
NW_022145615.1:4953281..4953305 21/25 Sense off-target LOC373247
NW_022145516.1:1549793..1549817 21/25 Sense off-target LOC763910
NW_022145519.1:119593..119617 21/25 Sense off-target LOC753954
NW_022145465.1:4735..4759 21/25 Sense off-target LOC577919
NW_022145514.1:910983..911007 21/25 Antisense off-target LOC580280
NW_022145516.1:1125801..1125825 21/25 Sense off-target LOC752335
NW_022145520.1:2248513..2248537 21/25 Sense off-target LOC585134
NW_022145526.1:808626..808650 21/25 Sense off-target LOC590120
NW_022145528.1:848326..848350 21/25 Antisense off-target LOC591623
NW_022145539.1:1544516..1544540 21/25 Antisense off-target LOC592701
NW_022145539.1:185775..185799 21/25 Sense off-target LOC582602
NW_022145539.1:834066..834090 21/25 Antisense off-target LOC579564
NW_022145538.1:461333..461357 21/25 Sense off-target LOC574636
NW_022145539.1:1244124..1244148 21/25 Antisense off-target LOC763984
NW_022145544.1:1811163..1811187 21/25 Antisense off-target LOC579964
NW_022145542.1:1125420..1125444 21/25 Antisense off-target LOC752157
NW_022145542.1:1126583..1126607 21/25 Antisense off-target LOC752157
NW_022145543.1:688320..688344 21/25 Antisense off-target LOC753927
NW_022145549.1:44369..44393 21/25 Antisense off-target LOC586037
NW_022145548.1:24506..24530 21/25 Sense off-target LOC587704
NW_022145548.1:55049..55073 21/25 Sense off-target LOC586424
NW_022145551.1:2048331..2048355 21/25 Sense off-target LOC594538
NW_022145551.1:2052466..2052490 21/25 Sense off-target LOC594538
NW_022145552.1:1801228..1801252 21/25 Sense off-target LOC579339
NW_022145552.1:21929..21953 21/25 Sense off-target LOC580204
NW_022145552.1:779277..779301 21/25 Sense off-target LOC754104
NW_022145558.1:2040653..2040677 21/25 Antisense off-target LOC588106
NW_022145554.1:1263310..1263334 21/25 Sense off-target LOC586681
NW_022145554.1:482853..482877 21/25 Antisense off-target LOC590856
NW_022145554.1:726597..726621 21/25 Sense off-target LOC763606
NW_022145558.1:93546..93570 21/25 Antisense off-target LOC579234
NW_022145559.1:322624..322648 21/25 Sense off-target LOC753978
NW_022145560.1:1042138..1042162 21/25 Antisense off-target LOC588136
NW_022145560.1:1049529..1049553 21/25 Antisense off-target LOC588136
NW_022145558.1:389779..389803 21/25 Sense off-target LOC575388
NW_022145558.1:430131..430155 21/25 Antisense off-target LOC591603
NW_022145558.1:477866..477890 21/25 Antisense off-target LOC581136
NW_022145558.1:900994..901018 21/25 Sense off-target LOC580270
NW_022145560.1:974331..974355 21/25 Antisense off-target LOC583387
NW_022145561.1:786846..786870 21/25 Antisense off-target LOC373230
NW_022145564.1:589355..589379 21/25 Antisense off-target LOC579464
NW_022145566.1:2367709..2367733 21/25 Sense off-target LOC763963
NW_022145566.1:2372510..2372534 21/25 Antisense off-target LOC763963
NW_022145570.1:1115706..1115730 21/25 Antisense off-target LOC373215
NW_022145570.1:1126926..1126950 21/25 Antisense off-target LOC373215
NW_022145570.1:3311238..3311262 21/25 Antisense off-target LOC577962
NW_022145566.1:846175..846199 21/25 Antisense off-target LOC578074
NW_022145566.1:849650..849674 21/25 Antisense off-target LOC578074
NW_022145572.1:174625..174649 21/25 Antisense off-target LOC586330