Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505996

Morpholino Name: gnai1 MO1
Synonyms:
Target mRNA: gnai1

Morpholino Type: translation blocking morpholino
Sequence: 5' GCTCGTAGCGCACCCCATGTTGGAA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145612.1:109..133 25/25 Antisense off-target LOC414054
NW_022145612.1:20276355..20276379 25/25 unknown
Publications
First: Evolutionary modification of AGS protein contributes to formation of micromeres in sea urchins., Nat Commun 2019                    
Most recent:
View All Papers