Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505990

Morpholino Name: gata6 MO2
Synonyms:
Target mRNA: gata6

Morpholino Type: translation blocking morpholino
Sequence: 5' CTCCTAGAATCAAGTGGGTTGCAG 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145613.1:25967940..25967963 20/24 Sense off-target LOC105437222
Publications
First: Dose-dependent nuclear β-catenin response segregates endomesoderm along the sea star primary axis., Development 2015  
Most recent:
View All Papers