Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505984

Morpholino Name: foxy MO1
Synonyms: FoxY MO2
Target mRNA: foxy

Morpholino Type: translation blocking morpholino
Sequence: 5' CATGGCTCCAAGTGCAGAACACTAC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 23/25
genomic

MO
5' ATAGTGTTCTGCACTTGAAGCCATG 3' |||||||||||||||| ||||||| 3' CATCACAAGACGTGAACCTCGGTAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145615.1:4516460..4516484 23/25 Antisense target foxy
NW_022145615.1:3766055..3766079 24/25 Antisense off-target LOC115920611
Publications
First: The forkhead transcription factor FoxY regulates Nanos., Mol Reprod Dev 2012  
Most recent: Distinct transcriptional regulation of Nanos2 in the germ line and soma by the Wnt and delta/notch pathways., Dev Biol 2019  
View All Papers