Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505983

Morpholino Name: foxg1 MO1
Synonyms:
Target mRNA: foxg1

Morpholino Type: translation blocking morpholino
Sequence: 5' ACTTCTTGCTAAATACCAAGGCGGA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' TCCGCCTTGGTATTTAGCAAGAAGT 3' ||||||||||||||||||||||||| 3' AGGCGGAACCATAAATCGTTCTTCA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:34684439..34684463 25/25 Antisense target foxg1
Publications
First: Geometric control of ciliated band regulatory states in the sea urchin embryo., Development 2015  
Most recent:
View All Papers