Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505982

Morpholino Name: foxe3l MO2
Synonyms: foxQ2-Mo
Target mRNA: foxe3l

Morpholino Type: translation blocking morpholino
Sequence: 5' GTTATCAATGCTGAACAGAGTCATG 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 21/25
genomic

MO
5' TATGACTTTATTCAGCATTGACAAC 3' |||||| | ||||||||||| ||| 3' GTACTGAGACAAGTCGTAACTATTG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145599.1:2433342..2433366 21/25 Antisense target foxe3l
NW_022145599.1:2399893..2399917 22/25 Sense off-target LOC583176
NW_022145599.1:2399893..2399917 22/25 Antisense off-target LOC583193
Publications
First: MAPK and GSK3/ß-TRCP-mediated degradation of the maternal Ets domain transcriptional repressor Yan/Tel controls the spatial expression of nodal in the sea urchin embryo., PLoS Genet 2018                  
Most recent:
View All Papers