Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505976

Morpholino Name: flt1 MO1
Synonyms: Lv-VEGFR-10-Ig splice-blocking MO
Target mRNA: flt1

Morpholino Type: splice blocking morpholino
Sequence: 5' TGATTAGGGATTGCTACTTACCTGA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: The evolution of a new cell type was associated with competition for a signaling ligand., PLoS Biol 2019                      
Most recent:
View All Papers