Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505959

Morpholino Name: etv6 MO4
Synonyms: yant/tel-Mo5' UTR
Target mRNA: etv6

Morpholino Type: translation blocking morpholino
Sequence: 5' ATGGTGTCAGGAGTGGGATCAACAC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 22/25
genomic

MO
5' GTTTTCATCCCACTCCTGACGCCAT 3' || || |||||||||||||| |||| 3' CACAACTAGGGTGAGGACTGTGGTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145603.1:13286017..13286041 22/25 Antisense target etv6
NW_022145595.1:14529877..14529901 22/25 Antisense off-target LOC584509
NW_022145604.1:3313593..3313617 22/25 Sense off-target LOC580186
NW_022145609.1:9319091..9319115 22/25 Sense off-target LOC590579
NW_022145611.1:23144794..23144818 22/25 Sense off-target LOC582217
NW_022145544.1:1432653..1432677 21/25 Sense off-target LOC586053
NW_022145544.1:1432831..1432855 21/25 Sense off-target LOC586053
NW_022145544.1:1433009..1433033 21/25 Sense off-target LOC586053
NW_022145572.1:1077380..1077404 21/25 Antisense off-target LOC591747
NW_022145596.1:1983484..1983508 21/25 Sense off-target LOC763960
NW_022145615.1:2313058..2313082 21/25 Sense off-target LOC757285
NW_022145603.1:11290314..11290338 22/25 Sense off-target LOC100892391
NW_022145604.1:2837003..2837027 22/25 Sense off-target LOC115918793
NW_022145610.1:895833..895857 22/25 Sense off-target LOC100889127
NW_022145594.1:17644132..17644156 21/25 Antisense off-target LOC100892303
NW_022145599.1:8802435..8802459 21/25 Antisense off-target LOC100889821
NW_022145603.1:9994657..9994681 21/25 Sense off-target LOC100888763
NW_022145606.1:5686854..5686878 21/25 Sense off-target LOC105438637
NW_022145609.1:8474712..8474736 21/25 Sense off-target LOC115928612
NW_022145612.1:44675203..44675227 21/25 Sense off-target LOC100892118
NW_022145612.1:44675562..44675586 21/25 Sense off-target LOC100892118
NW_022145611.1:23498854..23498878 22/25 unknown
NW_022145615.1:24521622..24521646 22/25 unknown
NW_022145596.1:4815467..4815491 21/25 unknown
NW_022145596.1:7172446..7172470 21/25 unknown
NW_022145598.1:3109299..3109323 21/25 unknown
NW_022145603.1:4884709..4884733 21/25 unknown
NW_022145607.1:31890672..31890696 21/25 unknown
Publications
First: MAPK and GSK3/ß-TRCP-mediated degradation of the maternal Ets domain transcriptional repressor Yan/Tel controls the spatial expression of nodal in the sea urchin embryo., PLoS Genet 2018                  
Most recent:
View All Papers