Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505948

Morpholino Name: emx1l MO1
Synonyms:
Target mRNA: emx1l

Morpholino Type: translation blocking morpholino
Sequence: 5' ATTGTCTCTTTTCAACCCTGTTTCT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' AGAAACAGGGTTGAAAAGAGACAAT 3' ||||||||||||||||||||||||| 3' TCTTTGTCCCAACTTTTCTCTGTTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145600.1:33278019..33278043 25/25 Antisense target emx1l
NW_022145598.1:5287073..5287097 21/25 Sense off-target LOC579431
NW_022145611.1:22166656..22166680 21/25 Sense off-target LOC578597
NW_022145543.1:648292..648316 21/25 unknown
NW_022145596.1:14825547..14825571 21/25 unknown
NW_022145601.1:22420102..22420126 21/25 unknown
NW_022145605.1:5141577..5141601 21/25 unknown
NW_022145615.1:31070540..31070564 21/25 unknown
Publications
First: Encoding regulatory state boundaries in the pregastrular oral ectoderm of the sea urchin embryo., Proc Natl Acad Sci U S A 2014  
Most recent:
View All Papers