Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505934

Morpholino Name: dach1l MO1
Synonyms:
Target mRNA: dach1l

Morpholino Type: translation blocking morpholino
Sequence: 5' AGTAGGCGGTGGACTTCCCATTTTC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145596.1:14553226..14553250 24/25 Antisense off-target dach1
Publications
First: Deployment of a retinal determination gene network drives directed cell migration in the sea urchin embryo., Elife 2015                                
Most recent:
View All Papers