Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505931

Morpholino Name: ctnnb1 MO1
Synonyms:
Target mRNA: ctnnb1

Morpholino Type: translation blocking morpholino
Sequence: 5' CTATTTCAGATATAATCTTGACGAG 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145612.1:43791089..43791113 21/25 Sense off-target pofut2
Publications
First: microRNAs regulate β-catenin of the Wnt signaling pathway in early sea urchin development., Dev Biol 2015  
Most recent:
View All Papers