Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505913

Morpholino Name: arid3a MO1
Synonyms:
Target mRNA: arid3a

Morpholino Type: translation blocking morpholino
Sequence: 5' CTGTCTTCGCTGGTGTTCAACC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 21/22
genomic

MO
5' GGTTGAAGACCAGCGAAGACAG 3' ||||||| |||||||||||||| 3' CCAACTTGTGGTCGCTTCTGTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145615.1:18484512..18484533 21/22 Antisense target arid3a
NW_022145594.1:23411775..23411796 19/22 Antisense off-target LOC577692
NW_022145615.1:34943782..34943803 18/22 Antisense off-target LOC578400
NW_022145615.1:34943840..34943861 18/22 Antisense off-target LOC578400
NW_022145594.1:22773987..22774008 19/22 Antisense off-target LOC105445097
NW_022145594.1:46002854..46002875 18/22 Sense off-target LOC115921161
NW_022145606.1:44010277..44010298 18/22 Sense off-target LOC115918887
NW_022145606.1:44010277..44010298 18/22 Sense off-target LOC115927472
Publications
First: Spdeadringer, a sea urchin embryo gene required separately in skeletogenic and oral ectoderm gene regulatory networks., Dev Biol 2003  
Most recent:
View All Papers