Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505909

Morpholino Name: dll1 MO4
Synonyms: Delta morpholino, Delta-MASO
Target mRNA: dll1

Morpholino Type: translation blocking morpholino
Sequence: 5' CAAGAAGGCAGTGCGGCCGATCCGT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' ACGGATCGGCCGCACTGCCTTCTTG 3' ||||||||||||||||||||||||| 3' TGCCTAGCCGGCGTGACGGAAGAAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:35186035..35186059 25/25 Antisense target dll1
NW_022145517.1:17241..17265 25/25 Antisense off-target LOC115921237
Publications
First: Reciprocal signaling between the ectoderm and a mesendodermal left-right organizer directs left-right determination in the sea urchin embryo., PLoS Genet 2012                        
Most recent: Notch-mediated lateral inhibition is an evolutionarily conserved mechanism patterning the ectoderm in echinoids., Dev Genes Evol 2018  
View All Papers