Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505908

Morpholino Name: dll1 MO3
Synonyms: Lv-Delta, delta-MO
Target mRNA: dll1

Morpholino Type: translation blocking morpholino
Sequence: 5' GTGCAGCCGATTCGTTATTCCTTT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 22/24
genomic

MO
5' AAAGGAATAACGGATCGGCCGCAC 3' |||||||||||| |||||| |||| 3' TTTCCTTATTGCTTAGCCGACGTG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:35186026..35186049 22/24 Antisense target dll1
NW_022145517.1:17251..17274 22/24 Antisense off-target LOC115921237
NW_022145615.1:33939675..33939698 20/24 unknown
NW_022145615.1:33987422..33987445 20/24 unknown
Publications
First: Deployment of a retinal determination gene network drives directed cell migration in the sea urchin embryo., Elife 2015                                
Most recent: Neurogenesis in the sea urchin embryo is initiated uniquely in three domains., Development 2018  
View All Papers