Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505905

Morpholino Name: cdk6 MO1
Synonyms:
Target mRNA: cdk6

Morpholino Type: translation blocking morpholino
Sequence: 5' ATGCCATCCTCTTCTCTGGTCCCTT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145612.1:47718496..47718520 21/25 Sense off-target LOC580332
Publications
First: Cyclin D and cdk4 are required for normal development beyond the blastula stage in sea urchin embryos., Mol Cell Biol 2002  
Most recent:
View All Papers