Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505902

Morpholino Name: bmp2 MO1
Synonyms: bmp2/4-MO
Target mRNA: bmp2

Morpholino Type: translation blocking morpholino
Sequence: 5' GACCCCAATGTGAGGTGGTAACCAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 24/25
genomic

MO
5' ATGGTTACCACTTCACATTGGGGTC 3' ||||||||||| ||||||||||||| 3' TACCAATGGTGGAGTGTAACCCCAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:36755848..36755872 24/25 Antisense target bmp2
Publications
First: Chordin is required for neural but not axial development in sea urchin embryos., Dev Biol 2009  
Most recent: Neurogenesis in the sea urchin embryo is initiated uniquely in three domains., Development 2018  
View All Papers