Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505901

Morpholino Name: prdm1 MO3
Synonyms:
Target mRNA: prdm1

Morpholino Type: translation blocking morpholino
Sequence: 5' CTCCCTTTCGCTTGAAAAACACCGC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' GCGGTGTTTTTCAAGCGAAAGGGAG 3' ||||||||||||||||||||||||| 3' CGCCACAAAAAGTTCGCTTTCCCTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145607.1:33436214..33436238 25/25 Antisense target prdm1
NW_022145607.1:91..115 25/25 Antisense off-target blimp1/krox
NW_022145613.1:10763856..10763880 21/25 unknown
Publications
First: An otx cis-regulatory module: a key node in the sea urchin endomesoderm gene regulatory network., Dev Biol 2004  
Most recent: Specific functions of the Wnt signaling system in gene regulatory networks throughout the early sea urchin embryo., Proc Natl Acad Sci U S A 2014  
View All Papers