Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505898

Morpholino Name: ascl1 MO1
Synonyms: Lv-AcSc
Target mRNA: ascl1

Morpholino Type: translation blocking morpholino
Sequence: 5' ACAATGTTCTCCATTTTGTGTCTTT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145614.1:6699922..6699946 21/25 Sense off-target gmds
NW_022145600.1:15076498..15076522 21/25 Sense off-target prom1
NW_022145606.1:44646692..44646716 21/25 Sense off-target LOC584260
NW_022144778.1:9570..9594 21/25 unknown
NW_022144973.1:3525..3549 21/25 unknown
NW_022145018.1:217341..217365 21/25 unknown
NW_022145597.1:12696082..12696106 21/25 unknown
NW_022145598.1:1691911..1691935 21/25 unknown
Publications
First: Identification of neural transcription factors required for the differentiation of three neuronal subtypes in the sea urchin embryo., Dev Biol 2018  
Most recent:
View All Papers