Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505896

Morpholino Name: alx1 MO1
Synonyms: SpAlx1 MO
Target mRNA: alx1

Morpholino Type: translation blocking morpholino
Sequence: 5' TATTGAGTTAAGTCTCGGCACGACA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities 25/25
genomic

MO
5' TGTCGTGCCGAGACTTAACTCAATA 3' ||||||||||||||||||||||||| 3' ACAGCACGGCTCTGAATTGAGTTAT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145603.1:14692817..14692841 25/25 Antisense target alx1
Publications
First: Alx1, a member of the Cart1/Alx3/Alx4 subfamily of Paired-class homeodomain proteins, is an essential component of the gene network controlling skeletogenic fate specification in the sea urchin embryo., Development 2003                
Most recent: Genome-wide analysis of the skeletogenic gene regulatory network of sea urchins., Development 2014  
View All Papers