Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase
Summary Attributions Wiki
ECB-MORPHOLINO-24505894

Morpholino Name: alx1 MO4
Synonyms: LvAlx1 MO
Target mRNA: alx1

Morpholino Type: translation blocking morpholino
Sequence: 5' ACGGCATTGACGGGTAGAATAACAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145594.1:44633025..44633049 21/25 unknown
Publications
First: Alx1, a member of the Cart1/Alx3/Alx4 subfamily of Paired-class homeodomain proteins, is an essential component of the gene network controlling skeletogenic fate specification in the sea urchin embryo., Development 2003                
Most recent:
View All Papers