Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-MORPHOLINO-26397111

Morpholino Name: cnot6l MO3
Synonyms: PRE1 MASO1
Target mRNA: cnot6l
Derived from:

Morpholino Type: target protector morpholino
Sequence: 5' AATAGCATCAATTTACACACTGTAC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus
Identities 25/25
genome
MO
5' GTACAGTGTGTAAATTGATGCTATT 3'
   |||||||||||||||||||||||||
3' CATGTCACACATTTAACTACGATAA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145595.1:20231802..20231826 25/25 Antisense target cnot6l
NW_022145607.1:18157772..18157796 21/25 Antisense off-target ift88
NW_022145594.1:1230077..1230101 21/25 Sense off-target LOC105442350
NW_022145559.1:17720..17744 21/25 unknown
P. miniata 3.0 NW_024037059.1:21893673..21893697 21/25 Antisense off-target LOC119728205
L. variegatus 3.0 chr1:10586265..10586289 21/25 Sense off-target LOC121427397
chr17:21300332..21300356 21/25 unknown
Publications
First: Deadenylase depletion protects inherited mRNAs in primordial germ cells., Development 2014  
Most recent:
View All Papers