Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-GRNA-26396950

gRNA Name: gcml gRNA6
Synonyms: Hp GCM 302-325
Genomic Target: gcml
Derived from:

Sequence: 5' GGCCGCCGGAGCTGCCGGAT 3'



Genomic Target S. purpuratus
Identities 18/20
genome
gRNA
5' ACCCGGCAGCTCCGGCGGCA 3'
   | ||||||||||||||||| 
3' TAGGCCGTCGAGGCCGCCGG 5'
     
Genomic Alignments Position Identity Strand Genomic Target
S. purpuratus 5.0 NW_022145598.1:34773820..34773839 18/20 Sense gcml
P. miniata 3.0 NW_024037074.1:32201784..32201803 17/20 Antisense LOC119744920
NW_024037056.1:13876646..13876665 16/20 Antisense LOC119724727
NW_024037056.1:13876646..13876665 16/20 Sense LOC119724728
NW_024037069.1:8585537..8585556 17/20
L. variegatus 3.0 chr2:36223660..36223679 17/20 Sense lonp2
chr1:54455454..54455473 17/20 Sense zbtb8os
Publications
First: Genetic manipulation of the pigment pathway in a sea urchin reveals distinct lineage commitment prior to metamorphosis in the bilateral to radial body plan transition., Sci Rep 2020                    
Most recent:
View All Papers