Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-MORPHOLINO-26396736

Morpholino Name: hmxl4 MO1
Synonyms: Nkx3-2MO1
Target mRNA: hmxl4
Derived from:

Morpholino Type: translation blocking morpholino
Sequence: 5' CGTTCATGTTGGTCTGAAATGATGC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus
Identities 25/25
genome
MO
5' GCATCATTTCAGACCAACATGAACG 3'
   |||||||||||||||||||||||||
3' CGTAGTAAAGTCTGGTTGTACTTGC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145600.1:30636250..30636274 25/25 Antisense target hmxl4
P. miniata 3.0 NW_024037059.1:38641683..38641707 21/25 unknown
NW_024037059.1:38625680..38625704 21/25 unknown
NW_024037059.1:38633923..38633947 21/25 unknown
L. variegatus 3.0 chr8:9092617..9092641 21/25 Sense off-target LOC121419937
Publications
First: Direct development of neurons within foregut endoderm of sea urchin embryos., Proc Natl Acad Sci U S A 2011  
Most recent:
View All Papers