Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-MORPHOLINO-26396721

Morpholino Name: prdm1 MO4
Synonyms: a krox MASO
Target mRNA: prdm1
Derived from:

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CAGGTCCTTTCATTCTGGTACTCAG 3'

Source: Gene Tools LLC


Target mRNA P. miniata
Identities 22/25
genome
MO
5' GAGAGTACCAGAATAAAAGGACCTG 3'
     |||||||||||| ||||||||||
3' GACTCATGGTCTTACTTTCCTGGAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
P. miniata 3.0 NW_024037074.1:10802962..10802986 22/25 Antisense target prdm1
NW_024037055.1:11999149..11999173 21/25 Sense off-target LOC119723838
Publications
First: Developmental gene regulatory network architecture across 500 million years of echinoderm evolution., Proc Natl Acad Sci U S A 2003  
Most recent:
View All Papers