Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-MORPHOLINO-26396379

Morpholino Name: sin3a MO1
Synonyms: Sin3A-MO
Target mRNA: sin3a
Derived from:

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TTGTAGCACCAACCAGAAGAAGAAT 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus
Identities 25/25
genome
MO
5' ATTCTTCTTCTGGTTGGTGCTACAA 3'
   |||||||||||||||||||||||||
3' TAAGAAGAAGACCAACCACGATGTT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145612.1:15839479..15839503 25/25 Antisense target sin3a
NW_022145602.1:15202190..15202214 21/25 unknown
NW_022145609.1:9780463..9780487 21/25 unknown
L. variegatus 3.0 chr4:29345561..29345585 21/25 Sense off-target LOC121413791
chr4:41851293..41851317 21/25 Sense off-target LOC121414077
Publications
First: ISWI contributes to ArsI insulator function in development of the sea urchin., Development 2012  
Most recent:
View All Papers