Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-MORPHOLINO-26396378

Morpholino Name: LOC583705 MO1
Synonyms: ISWI-MO
Target mRNA: LOC583705
Derived from:

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TTGCACGAAAGTAAGTGTGTTACGA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus
Identities 25/25
genome
MO
5' TCGTAACACACTTACTTTCGTGCAA 3'
   |||||||||||||||||||||||||
3' AGCATTGTGTGAATGAAAGCACGTT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145596.1:17929461..17929485 25/25 Antisense target LOC583705
Publications
First: ISWI contributes to ArsI insulator function in development of the sea urchin., Development 2012  
Most recent:
View All Papers