Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-GRNA-26395120

gRNA Name: LOC584189 gRNA5
Synonyms: PmDsh 138
Genomic Target: LOC584189
Derived from:

Sequence: 5' TTGGCAACTTCACAAGGTAC 3'



Genomic Target S. purpuratus A. planci P. miniata L. variegatus
Identities
genome
gRNA
Genomic Alignments Position Identity Strand Genomic Target
S. purpuratus 5.0 NW_022145603.1:22296565..22296584 17/20 Antisense LOC752046
NW_022145605.1:39206263..39206282 17/20 Sense LOC585019
NW_022145600.1:19351826..19351845 17/20 Antisense LOC100893702
NW_022145609.1:34966558..34966577 16/20 Antisense ptch1
NW_022145602.1:6247846..6247865 16/20 Antisense cep290
NW_022145599.1:5756034..5756053 16/20 Antisense LOC100891500
NW_022145613.1:31489751..31489770 16/20 Antisense LOC100893974
P. miniata 3.0 NW_024037074.1:3358708..3358727 19/20 Antisense LOC119746324
NW_024037069.1:10555597..10555616 17/20 Sense pqbp1
NW_024037052.1:6852877..6852896 17/20 Sense wnt10b
NW_024037069.1:10555597..10555616 17/20 Antisense LOC119737471
NW_024037069.1:38231469..38231488 17/20 Antisense LOC119736878
NW_024037074.1:44328201..44328220 16/20 Antisense psme3
NW_024037074.1:41758874..41758893 16/20 Antisense snap25
NW_024037052.1:6324234..6324253 16/20 Antisense LOC119721978
NW_024037072.1:10011581..10011600 16/20 Antisense LOC119740515
NW_024037064.1:14736138..14736157 17/20
L. variegatus 3.0 chr3:39636607..39636626 18/20 Sense LOC121410994
chr1:90400056..90400075 17/20 Antisense fdft1
chr1:61500053..61500072 16/20 Antisense LOC121406492
chr1:67142195..67142214 16/20 Antisense LOC121431659
chr4:17539715..17539734 16/20 Antisense LOC121413521
chr4:20426065..20426084 16/20 Antisense LOC121413583
chr5:38252278..38252297 16/20 Antisense LOC121415451
chr18:13764571..13764590 16/20
chr5:42045332..42045351 16/20
chr9:1389800..1389819 16/20
chr9:4015844..4015863 16/20
Publications
First: Optimizing CRISPR/Cas9-based gene manipulation in echinoderms., Dev Biol 2022  
Most recent:
View All Papers