Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-GRNA-26395118

gRNA Name: LOC584189 gRNA3
Synonyms: PmDsh 17
Genomic Target: LOC584189
Derived from:

Sequence: 5' CATATACCACATAGACGATG 3'



Genomic Target
Identities
genome
gRNA
     
Genomic Alignments Position Identity Strand Genomic Target
S. purpuratus 5.0 NW_022145612.1:30510678..30510697 17/20 Sense abcc9
NW_022145542.1:15476..15495 17/20 Sense LOC575256
NW_022145612.1:30536519..30536538 17/20 Sense LOC115919249
NW_022145612.1:30417521..30417540 16/20 Sense LOC588997
NW_022145611.1:26245223..26245242 18/20
NW_022145609.1:4930950..4930969 16/20
NW_022145611.1:32972079..32972098 16/20
P. miniata 3.0 NW_024037074.1:3358738..3358757 20/20 Sense LOC119746324
NW_024037049.1:4775837..4775856 18/20 Sense LOC119741078
NW_024037066.1:8063050..8063069 18/20 Sense LOC119734628
NW_024037074.1:21056208..21056227 17/20 Sense hdc
NW_024037061.1:9865702..9865721 19/20
NW_024037071.1:9445285..9445304 16/20
L. variegatus 3.0 chr3:63827106..63827125 16/20 Antisense selenbp1
chr2:4130962..4130981 16/20 Sense LOC121407104
chr2:6908039..6908058 16/20 Sense LOC121407182
chr8:10390937..10390956 16/20 Antisense LOC121420637
Publications
First: Optimizing CRISPR/Cas9-based gene manipulation in echinoderms., Dev Biol 2022  
Most recent:
View All Papers