Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-MORPHOLINO-26395013

Morpholino Name: cah2 MO3
Synonyms:
Target mRNA: cah2
Derived from:

Morpholino Type: control morpholino
Sequence: 5' CCTCTTACCTCAGTTACAATTTATA 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: Extracellular carbonic anhydrase activity promotes a carbon concentration mechanism in metazoan calcifying cells., Proc Natl Acad Sci U S A 2022  
Most recent:
View All Papers