Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-MORPHOLINO-26395012

Morpholino Name: cah2 MO2
Synonyms: Cara7 MO
Target mRNA: cah2
Derived from:

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' CGACCTTCAGATATATTCTCACAAA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus
Identities 25/25
genome
MO
5' TTTGTGAGAATATATCTGAAGGTCG 3'
   |||||||||||||||||||||||||
3' AAACACTCTTATATAGACTTCCAGC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145605.1:5691177..5691201 25/25 Antisense target cah2
NW_022145601.1:31541203..31541227 21/25 unknown
P. miniata 3.0 NW_024037063.1:4651896..4651920 21/25 Sense off-target LOC119731893
L. variegatus 3.0 chr7:17468006..17468030 21/25 Sense off-target LOC121418604
Publications
First: Extracellular carbonic anhydrase activity promotes a carbon concentration mechanism in metazoan calcifying cells., Proc Natl Acad Sci U S A 2022  
Most recent:
View All Papers