Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-MORPHOLINO-26394992

Morpholino Name: cah2 MO1
Synonyms: Cara7 MO
Target mRNA: cah2
Derived from:

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' AAAATATATGCATTCATGTTGATCA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus
Identities 25/25
genome
MO
5' TGATCAACATGAATGCATATATTTT 3'
   |||||||||||||||||||||||||
3' ACTAGTTGTACTTACGTATATAAAA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145605.1:5691127..5691151 25/25 Antisense target cah2
NW_022145600.1:35200026..35200050 21/25 Sense off-target LOC752636
NW_022145605.1:35834935..35834959 21/25 Antisense off-target LOC592143
NW_022145611.1:41637510..41637534 21/25 Antisense off-target LOC579490
NW_022145594.1:49741025..49741049 21/25 Sense off-target LOC115921427
NW_022145605.1:22413300..22413324 21/25 Antisense off-target LOC115918233
NW_022145612.1:60717327..60717351 21/25 Sense off-target LOC115919230
NW_022145612.1:61232558..61232582 21/25 Sense off-target LOC100892995
NW_022145594.1:39667173..39667197 22/25 unknown
NW_022145594.1:39640891..39640915 22/25 unknown
NW_022145594.1:39647404..39647428 22/25 unknown
NW_022145594.1:39664238..39664262 22/25 unknown
NW_022145597.1:18937509..18937533 22/25 unknown
NW_022145613.1:17659871..17659895 22/25 unknown
NW_022145613.1:18484187..18484211 22/25 unknown
NW_022145596.1:28388293..28388317 21/25 unknown
NW_022145514.1:987002..987026 21/25 unknown
NW_022145523.1:190335..190359 21/25 unknown
NW_022145594.1:39660893..39660917 21/25 unknown
NW_022145614.1:24013894..24013918 21/25 unknown
NW_022145598.1:1020022..1020046 21/25 unknown
NW_022145604.1:18121001..18121025 21/25 unknown
NW_022145605.1:20887195..20887219 21/25 unknown
NW_022145609.1:2369708..2369732 21/25 unknown
NW_022145611.1:31546022..31546046 21/25 unknown
NW_022145613.1:36306220..36306244 21/25 unknown
P. miniata 3.0 NW_024037049.1:4087671..4087695 21/25 Sense off-target eif3k
NW_024037056.1:11939908..11939932 21/25 Antisense off-target LOC119724632
NW_024037057.1:6579576..6579600 21/25 Antisense off-target LOC119725546
NW_024037059.1:6068083..6068107 21/25 Sense off-target LOC119727169
NW_024037059.1:6592373..6592397 21/25 Sense off-target LOC119728334
XR_005270910.1:2611..2635 21/25 Sense off-target LOC119727169
XR_005270911.1:2679..2703 21/25 Sense off-target LOC119727169
XR_005271039.1:2665..2689 21/25 Sense off-target LOC119728334
NW_024037057.1:11593589..11593613 21/25 unknown
NW_024037065.1:9297826..9297850 21/25 unknown
L. variegatus 3.0 chr2:61084539..61084563 24/25 Antisense off-target LOC121408538
chr9:5894936..5894960 22/25 Sense off-target LOC121421003
chr3:4761763..4761787 21/25 Sense off-target lrrc71
chr3:4857512..4857536 21/25 Sense off-target LOC121410044
chr4:17150301..17150325 21/25 Antisense off-target LOC121413511
chr8:24643421..24643445 21/25 Sense off-target LOC121420217
chr10:10134349..10134373 21/25 Antisense off-target LOC121422290
chr15:7782915..7782939 21/25 Antisense off-target LOC121429244
chr2:46372572..46372596 21/25 Sense off-target LOC121408163
chr4:49282441..49282465 21/25 unknown
chr4:58904940..58904964 21/25 unknown
chr4:62444574..62444598 21/25 unknown
chr1:18493386..18493410 21/25 unknown
chr14:14964943..14964967 21/25 unknown
chr19:3304117..3304141 21/25 unknown
Publications
First: Extracellular carbonic anhydrase activity promotes a carbon concentration mechanism in metazoan calcifying cells., Proc Natl Acad Sci U S A 2022  
Most recent:
View All Papers